Last data update: 24 January 2024 16:39 CET
Plasmid name: pENTR207-CATMAXyZZZZZ (LMBP 337)
| New search | Print data sheet |
| Price category: | Cat. 2 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
p337.gb
(View with Genome Compiler) p337.txt p337.pdf |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Arabidopsis thaliana gene-specific tag (GST) |
| Promoter: | - |
| Ribosome binding site: |
- |
| Terminator: | Escherichia coli rrnB operon T1 terminator Escherichia coli rrnB operon T2 terminator |
| Selection marker: | Gentamicin (Gm) |
| Replicon: | Escherichia coli plasmid pMB1 origin |
| Host range: | Escherichia coli |
| Parental clone: | pDONR207 |
| Further information: | This datasheet is representative for all the pENTR207-CATMA plasmids available at BCCM/GeneCorner under library accession number LMBP LIB26. Consequently, the accession number 'LMBP 337' of this template clone is fictitious. pENTR207-CATMAXyZZZZZ is a Gateway entry vector containing an authenticated A. thaliana GST. In the framework of the European AGRIKOLA programme, the GST amplified from Arabidopsis genomic DNA was inserted in the pDONR207 vector (Invitrogen) using the Gateway BP reaction. The cloning protocols are described on the AGRIKOLA web site (www.agrikola.org). Information of the characterised GST is available in the online CATMA database (http://www.catma.org). A list of the validated pENTR207-CATMA plasmids can be found on http://bccm.belspo.be/catalogues/genecorner-dna-libraries/genecorner-gst-clones. In the compiled nucleotide sequence of this template entry vector, the GST sequence is replaced by a stretch of 200 'N' nucleotides (CATMAXyZZZZZ), flanked by the attL1 and attL2 recombination sites. Note that in the GST amplicon, the Arabidopsis gDNA is bracketted by a 17-nucleotide adaptor on either side (for more information see http://www.catma.org/extensions.html). |
| EMBL Accession number: | - |
| Latest sequence update: | 17/05/2005 |
| Sequence detail: | DNR5 primer: 5' CTGGCAGTTCCCTACTCTCG 3' DNR3 primer: 5' GATGGTCGGAAGAGGCATAA 3' |
| Authenticity test: | The criteria to authenticate the Gateway GST entry clones are: (1) the presence of an attL1-GST-attL2 cassette into the pDONR207-derived entry clone with a size compatible with the expected GST, as demonstrated by the DNA gel analysis of PCR amplicons; (2) a GST sequence obtained from the purified entry clone that shares at least 95% homology with the expected GST, over an alignment of at least 60 nucleotides. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by the Functional Genomics Division(1) on behalf of the AGRIKOLA consortium(2). (1) Department of Plant Systems Biology, Ghent University, Belgium (2) www.agrikola.org |
| Plasmid reference: | Hilson et al., Genome Res. 14 (2004), 2176-2189 [PMID: 15489341] |
| Related plasmid reference: | Manual of Gateway Cloning Technology (Invitrogen) |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 DH5α |
| Host reference: | Focus 8 (1986), 9 |
| Related host reference: | Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
| Cultivation medium: | LB-Lennox + gentamicin (10 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
| Related website: | http://bccm.belspo.be/catalogues/lmbp-gst-clones |
Refer in your Materials and Methods: |
pENTR207-CATMAXyZZZZZ (LMBP 337) is available at BCCM/GeneCorner. This plasmid was deposited by the Functional Genomics Division on behalf of the AGRIKOLA consortium and was published in Hilson et al., 2004. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.