Last data update: 24 January 2024 16:39 CET
Plasmid name: pEX1SOD (LMBP 5021)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
p5021.gb
(View with Genome Compiler) p5021.pdf |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Nicotiana plumbaginifolia manganese superoxide dismutase cDNA (MnSOD) |
| Promoter: | Agrobacterium tumefaciens Ti-plasmid nopaline synthase promoter (nos) Cauliflower mosaic virus (CaMV) 35S promoter Escherichia coli lac operon promoter; mutant (lacUV5) |
| Ribosome binding site: |
- |
| Terminator: | Agrobacterium tumefaciens Ti-plasmid octopine synthase terminator (ocs) |
| Selection marker: | Neomycin (neo; kanamycin (kan)) Streptomycin (Sm; spectinomycin (Sp)) |
| Replicon: | Escherichia coli plasmid pMB1 origin Pseudomonas plasmid pVS1 origin |
| Host range: | Escherichia coli Plant cells |
| Parental clone: | pSOD1; pGSJ780A |
| Further information: | The plasmid was constructed by inserting the 956 bp HpaI-SmaI fragment of pSOD1, containing the Nicotiana plumbaginifolia manganese superoxide dismutase (MnSOD) cDNA, into the ClaI (filled-in) opened pGSJ780A vector. The orientation of the inserted fragment is sense relative to the CaMV promoter. pEX1SOD was designed for mitochondrial MnSOD overproduction under control of the CaMV promoter. The plasmid contains a neomycin resistance cassette consisting of the Agrobacterium tumefaciens Ti-plasmid nopaline synthase (nos) promoter, the neomycin (neo, nptII) resistance gene, and the A. tumefaciens Ti-plasmid octopine synthase (ocs) terminator, that can be used for selection of transformed plants. When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. The nucleotide sequence of the MnSOD cDNA corresponds with the Genbank accession number X14482.1. Name mentioned in Bowler et al. (1991) is pMitSOD. |
| EMBL Accession number: | X14482.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 09/09/2005 |
| Sequence detail: | The nucleotide sequence of the insert:
--- CaMV promoter --> |-------- 5'UTR of MnSOD ----
5' ... TCATTTGGAGAGGACACGCTGAAATCACCAGTCTCTCTCTACAAATCG|AACAGCTAGAAAGCATTTAGGAATATCT
filled-in ClaI|HpaI fusion
----> --- mitochondrium transit MnSOD signal sequence --> ------------- MnSOD
CAAAA.ATG.GCA.CTA.CGA.ACC.CTA ... CGC.CAG.CAA.CTC.CGC.GGC.TTG.CAG.ACC.TTT.TCG
Met Ala Leu Arg Thr Leu Arg Gln Gln Leu Arg Gly Leu Gln Thr Phe Ser
*** SacII
mature sequence --------------> ------ 3'UTR of MnSOD ------>
CTC ... GAG.AAA.GAA.TGT.CCT.TGA.ACAGGGATATTT ... TTTGAGCGCAAACCCCCCCCCCCCCCTG
Leu Glu Lys Glu Cys Pro +++ PstI
| --- 3'UTR of Ti-7 -->
CAGGTCGACTCTAGAGGATCCCC|CGATGGATCCCCCGATGAGCTAAGCTAGCTATATCATCAATTT ... 3'
SalI XbaI BamHI | BamHI NheI
HindII SmaI|filled-in ClaI fusion
***: Start codon.
+++: Termination codon.
Punctuation indicates reading frame. |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: BamHI/ClaI, BglII, EcoRV/NheI, HindII, HindIII/SacII, HpaI/SmaI, NdeI and PvuII. The PvuII site at position 12718 could not be experimentally confirmed. The compiled nucleotide sequence has not been adapted accordingly. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Prof. Dr D. Inzé(1) (2) and constructed by C. Bowler(1) (2). (1) Department of Plant Systems Biology, VIB, Ghent, Belgium (2) Department of Plant Systems Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | Bowler et al., EMBO J. 10 (1991), 1723-1732 [PMID: 2050109] |
| Related plasmid reference: | McKersie et al., Plant Physiol. 103 (1993), 1155-1163 [PMID: 8290627] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061 |
| Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
| Cultivation medium: | LB-Lennox + spectinomycin (150 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pEX1SOD (LMBP 5021) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr D. Inzé and constructed by C. Bowler and was published in Bowler et al., 1991. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.