GREAT AT SMALL THINGS

GeneCorner plasmid details

Last data update: 24 March 2019 04:10 CET  


Name: pEX1SOD   Add to cart
Accession number: LMBP 5021
Sequence file: Depositor's sequence: p5021.gb     View with Genome Compiler
Circular map: p5021.pdf
Status: GeneCorner core plasmid
Cloned DNA: Nicotiana plumbaginifolia manganese superoxide dismutase cDNA (MnSOD)
Promoter: Agrobacterium tumefaciens Ti-plasmid nopaline synthase promoter (nos)
Cauliflower mosaic virus (CaMV) 35S promoter
Escherichia coli lac operon promoter; mutant (lacUV5)
Ribosome
binding site:
-
Terminator: Agrobacterium tumefaciens Ti-plasmid octopine synthase terminator (ocs)
Selection marker: Neomycin (neo; kanamycin (kan))
Streptomycin (Sm; spectinomycin (Sp))
Replicon: Escherichia coli plasmid pMB1 origin
Pseudomonas plasmid pVS1 origin
Host range: Escherichia coli
Plant cells
Parental clone: pSOD1; pGSJ780A
Further information: The plasmid was constructed by inserting the 956 bp HpaI-SmaI fragment of pSOD1, containing the Nicotiana plumbaginifolia manganese superoxide dismutase (MnSOD) cDNA, into the ClaI (filled-in) opened pGSJ780A vector. The orientation of the inserted fragment is sense relative to the CaMV promoter.
pEX1SOD was designed for mitochondrial MnSOD overproduction under control of the CaMV promoter.
The plasmid contains a neomycin resistance cassette consisting of the Agrobacterium tumefaciens Ti-plasmid nopaline synthase (nos) promoter, the neomycin (neo, nptII) resistance gene, and the A. tumefaciens Ti-plasmid octopine synthase (ocs) terminator, that can be used for selection of transformed plants.
When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide.
The nucleotide sequence of the MnSOD cDNA corresponds with the Genbank accession number X14482.1.
Name mentioned in Bowler et al. (1991) is pMitSOD.
EMBL Accession number: X14482.1, view at EMBL, GenBank, DDBJ
Latest sequence update: 09/09/2005
Sequence detail:
The nucleotide sequence of the insert:


      --- CaMV promoter -->                            |-------- 5'UTR of MnSOD ----
5' ... TCATTTGGAGAGGACACGCTGAAATCACCAGTCTCTCTCTACAAATCG|AACAGCTAGAAAGCATTTAGGAATATCT
                                         filled-in ClaI|HpaI fusion 


       ----> --- mitochondrium transit MnSOD signal sequence --> ------------- MnSOD
       CAAAA.ATG.GCA.CTA.CGA.ACC.CTA ... CGC.CAG.CAA.CTC.CGC.GGC.TTG.CAG.ACC.TTT.TCG
             Met Ala Leu Arg Thr Leu     Arg Gln Gln Leu Arg Gly Leu Gln Thr Phe Ser
             ***                                       SacII

       mature sequence --------------> ------ 3'UTR of MnSOD ------>
       CTC ... GAG.AAA.GAA.TGT.CCT.TGA.ACAGGGATATTT ... TTTGAGCGCAAACCCCCCCCCCCCCCTG
       Leu     Glu Lys Glu Cys Pro +++                                           PstI

                              |                       --- 3'UTR of Ti-7 -->
       CAGGTCGACTCTAGAGGATCCCC|CGATGGATCCCCCGATGAGCTAAGCTAGCTATATCATCAATTT ... 3'
          SalI  XbaI  BamHI   |    BamHI              NheI
          HindII          SmaI|filled-in ClaI fusion


***: Start codon.
+++: Termination codon.
Punctuation indicates reading frame.
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: BamHI/ClaI, BglII, EcoRV/NheI, HindII, HindIII/SacII, HpaI/SmaI, NdeI and PvuII.

The PvuII site at position 12718 could not be experimentally confirmed. The compiled nucleotide sequence has not been adapted accordingly.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Prof. Dr D. Inzδ(1) (2) and constructed by C. Bowler(1) (2).
(1) Department of Plant Systems Biology, VIB, Ghent, Belgium
(2) Department of Plant Systems Biology, Ghent University, Ghent, Belgium
Plasmid reference: Bowler et al., EMBO J. 10 (1991), 1723-1732 [PMID: 2050109]
Related plasmid reference: McKersie et al., Plant Physiol. 103 (1993), 1155-1163 [PMID: 8290627]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061
Host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Related host reference: Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111]
Cultivation medium: LB-Lennox + spectinomycin (150 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

 

New search