Last data update: 24 January 2024 16:39 CET
Plasmid name: pEXSOD10 (LMBP 5023)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner core plasmid |
GeneCorner sequence: |
p5023.gb
(View with Genome Compiler) p5023.pdf |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Pisum sativum ribulose 1,5-bisphospate carboxylase small subunit cDNA (rbcS, RuBP, RuBisCo); signal sequence Arabidopsis thaliana iron superoxide dismutase cDNA (FeSOD); mature sequence |
Promoter: | Agrobacterium tumefaciens Ti-plasmid nopaline synthase promoter (nos) Cauliflower mosaic virus (CaMV) 35S promoter Escherichia coli lac operon promoter; mutant (lacUV5) |
Ribosome binding site: |
- |
Terminator: | Agrobacterium tumefaciens Ti-plasmid octopine synthase terminator (ocs) |
Selection marker: | Neomycin (neo; kanamycin (kan)) Streptomycin (Sm; spectinomycin (Sp)) |
Replicon: | Escherichia coli plasmid pMB1 origin Pseudomonas plasmid pVS1 origin |
Host range: | Escherichia coli Plant cells |
Parental clone: | pSOD10; pKAH1; pGSJ780A |
Further information: | The plasmid was constructed as follows: 1) The mature sequence of Arabidopsis thaliana iron superoxide dismutase (FeSOD) was PCR amplified using pSOD10 as template. 2) The amplified fragment was cloned in a dT-tailed, HincII digested pUC18 vector. 3) The fragment was re-excised by a BamHI-BglII digest and cloned into the BamHI site of pKAH1. 4) Finally, the ClaI-BamHI fragment of this construct was inserted between the ClaI and BamHI sites of pGSJ780A. As a result, the FeSOD mature sequence was fused to the chloroplast transit signal sequence of the Pisum sativum ribulose 1,5-bisphospate carboxylase small subunit (rbcS, RuBP, RuBisCo). pEXSOD10 was designed for chloroplastic FeSOD overproduction under control of the CaMV promoter. The plasmid contains a neomycin resistance cassette consisting of the Agrobacterium tumefaciens Ti-plasmid nopaline synthase (nos) promoter, the neomycin (neo, nptII) resistance gene, and the A. tumefaciens Ti-plasmid octopine synthase (ocs) terminator, that can be used for selection of transformed plants. When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. The nucleotide sequence of the rbcS cDNA corresponds with the Genbank accession number X00806.1. The nucleotide sequence of the FeSOD cDNA corresponds with the Genbank accession number NM_118642.2. |
EMBL Accession number: | X00806.1, view at EMBL, GenBank, DDBJ NM_118642.2, view at GenBank |
Latest sequence update: | 05/09/2005 |
Sequence detail: | Primers used to amplify the mature sequence of Arabidopsis thaliana iron superoxide dismutase (FeSOD) on pSOD10: forward: 5' TCAAGTGCTGTAGATCTAAACTACGTCCTC 3' BglII reverse: 5' ACACACAAAACGGATCCACACTCAGAAAAG 3' BamHI The nucleotide sequence of the insert: ------------ signal seq. of 1 5á ... CTCTCTACAAATCGATAAGCTTTGCAATTCATACAGAAGTGAGAAAA.ATG.GCT.TCT.ATG.ATA.TCC ... ClaI HindIII Met Ala Ser Met Ile Ser *** EcoRV rbcS -------------> | ------------ mature seq. of FeSOD ------------> 57 58 | 10 212 GGA.AGA.GTA.AAG.TGC.ATG|GAT.CTA.AAC.TAC.GTC.CTC.AAG ... AAG.GCT.GCT.TCT.GCT.TAA Gly Arg Val Lys Cys Met|Asp Leu Asn Tyr Val Leu Lys Lys Ala Ala Ser Ala +++ BamHI|BglII fusion ---------- 3'UTR of FeSOD ---------> GCAAATTTCTGAACA ... CTCTTTTCTGAGTGTGGATCCCCCGATGAGC ... 3á BamHI ***: Start codon. +++: Termination codon. Punctuation indicates reading frame. |
Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: BamHI/ClaI, BglII, HindII, HindIII, NdeI, PvuII and SphI. The PvuII site at position 12754 could not be experimentally confirmed. The compiled nucleotide sequence has not been adapted accordingly. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Prof. Dr D. Inzé(1) (2) and constructed by W. Van Camp(1) (2). (1) Department of Plant Systems Biology, VIB, Ghent, Belgium (2) Department of Plant Systems Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | Van Camp et al., Plant Physiol. 112 (1996), 1703-1714 [PMID: 8972606] |
Related plasmid reference: | McKersie et al., Plant Physiol. 122 (2000), 1427-1437 [PMID: 10759538] |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 MC1061 |
Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
Cultivation medium: | LB-Lennox + spectinomycin (150 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Cultivation remark: | - |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pEXSOD10 (LMBP 5023) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr D. Inzé and constructed by W. Van Camp and was published in Van Camp et al., 1996. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.