GREAT AT SMALL THINGS

GeneCorner plasmid details

Last data update: 20 March 2019 04:17 CET  


Name: pEXSOD10   Add to cart
Accession number: LMBP 5023
Sequence file: Depositor's sequence: p5023.gb     View with Genome Compiler
Circular map: p5023.pdf
Status: GeneCorner core plasmid
Cloned DNA: Pisum sativum ribulose 1,5-bisphospate carboxylase small subunit cDNA (rbcS, RuBP, RuBisCo); signal sequence
Arabidopsis thaliana iron superoxide dismutase cDNA (FeSOD); mature sequence
Promoter: Agrobacterium tumefaciens Ti-plasmid nopaline synthase promoter (nos)
Cauliflower mosaic virus (CaMV) 35S promoter
Escherichia coli lac operon promoter; mutant (lacUV5)
Ribosome
binding site:
-
Terminator: Agrobacterium tumefaciens Ti-plasmid octopine synthase terminator (ocs)
Selection marker: Neomycin (neo; kanamycin (kan))
Streptomycin (Sm; spectinomycin (Sp))
Replicon: Escherichia coli plasmid pMB1 origin
Pseudomonas plasmid pVS1 origin
Host range: Escherichia coli
Plant cells
Parental clone: pSOD10; pKAH1; pGSJ780A
Further information: The plasmid was constructed as follows: 1) The mature sequence of Arabidopsis thaliana iron superoxide dismutase (FeSOD) was PCR amplified using pSOD10 as template. 2) The amplified fragment was cloned in a dT-tailed, HincII digested pUC18 vector. 3) The fragment was re-excised by a BamHI-BglII digest and cloned into the BamHI site of pKAH1. 4) Finally, the ClaI-BamHI fragment of this construct was inserted between the ClaI and BamHI sites of pGSJ780A. As a result, the FeSOD mature sequence was fused to the chloroplast transit signal sequence of the Pisum sativum ribulose 1,5-bisphospate carboxylase small subunit (rbcS, RuBP, RuBisCo).
pEXSOD10 was designed for chloroplastic FeSOD overproduction under control of the CaMV promoter.
The plasmid contains a neomycin resistance cassette consisting of the Agrobacterium tumefaciens Ti-plasmid nopaline synthase (nos) promoter, the neomycin (neo, nptII) resistance gene, and the A. tumefaciens Ti-plasmid octopine synthase (ocs) terminator, that can be used for selection of transformed plants.
When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide.
The nucleotide sequence of the rbcS cDNA corresponds with the Genbank accession number X00806.1.
The nucleotide sequence of the FeSOD cDNA corresponds with the Genbank accession number NM_118642.2.
EMBL Accession number: X00806.1, view at EMBL, GenBank, DDBJ
NM_118642.2, view at EMBL, GenBank, DDBJ
Latest sequence update: 05/09/2005
Sequence detail:
Primers used to amplify the mature sequence of Arabidopsis thaliana iron 
superoxide dismutase (FeSOD) on pSOD10:

forward:   5' TCAAGTGCTGTAGATCTAAACTACGTCCTC 3'
                         BglII

reverse:   5' ACACACAAAACGGATCCACACTCAGAAAAG 3'
                         BamHI



The nucleotide sequence of the insert:
                                                       ------------ signal seq. of
                                                       1 
5á ... CTCTCTACAAATCGATAAGCTTTGCAATTCATACAGAAGTGAGAAAA.ATG.GCT.TCT.ATG.ATA.TCC ...
                 ClaI  HindIII                         Met Ala Ser Met Ile Ser
                                                       ***           EcoRV

   rbcS ------------->    |        ------------ mature seq. of FeSOD ------------>
                   57  58 |        10                                      212
   GGA.AGA.GTA.AAG.TGC.ATG|GAT.CTA.AAC.TAC.GTC.CTC.AAG ... AAG.GCT.GCT.TCT.GCT.TAA
   Gly Arg Val Lys Cys Met|Asp Leu Asn Tyr Val Leu Lys     Lys Ala Ala Ser Ala +++
                     BamHI|BglII fusion


   ---------- 3'UTR of FeSOD --------->   
   GCAAATTTCTGAACA ... CTCTTTTCTGAGTGTGGATCCCCCGATGAGC ... 3á
                                      BamHI

***: Start codon.
+++: Termination codon.
Punctuation indicates reading frame.
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: BamHI/ClaI, BglII, HindII, HindIII, NdeI, PvuII and SphI.

The PvuII site at position 12754 could not be experimentally confirmed. The compiled nucleotide sequence has not been adapted accordingly.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Prof. Dr D. Inzδ(1) (2) and constructed by W. Van Camp(1) (2).
(1) Department of Plant Systems Biology, VIB, Ghent, Belgium
(2) Department of Plant Systems Biology, Ghent University, Ghent, Belgium
Plasmid reference: Van Camp et al., Plant Physiol. 112 (1996), 1703-1714 [PMID: 8972606]
Related plasmid reference: McKersie et al., Plant Physiol. 122 (2000), 1427-1437 [PMID: 10759538]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061
Host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Related host reference: Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111]
Cultivation medium: LB-Lennox + spectinomycin (150 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

 

New search