GREAT AT SMALL THINGS

GeneCorner plasmid details

Last data update: 25 March 2019 04:20 CET  


Name: pEXSOD11OFF   Add to cart
Accession number: LMBP 5024
Sequence file: Depositor's sequence: p5024.gb     View with Genome Compiler
Circular map: p5024.pdf
Status: GeneCorner core plasmid
Cloned DNA: Arabidopsis thaliana iron superoxide dismutase cDNA (FeSOD); mature sequence
Promoter: Agrobacterium tumefaciens Ti-plasmid nopaline synthase promoter (nos)
Cauliflower mosaic virus (CaMV) 35S promoter
Escherichia coli lac operon promoter; mutant (lacUV5)
Ribosome
binding site:
-
Terminator: Agrobacterium tumefaciens Ti-plasmid octopine synthase terminator (ocs)
Selection marker: Neomycin (neo; kanamycin (kan))
Streptomycin (Sm; spectinomycin (Sp))
Replicon: Escherichia coli plasmid pMB1 origin
Pseudomonas plasmid pVS1 origin
Host range: Escherichia coli
Plant cells
Parental clone: pSOD10; pGSJ780A
Further information: The plasmid was constructed as follows: 1) The mature sequence of Arabidopsis thaliana iron superoxide dismutase (FeSOD) was PCR amplified using pSOD10 as template. 2) The amplified fragment was cloned in a dT-tailed, HincII digested pUC18 vector. 3) The fragment was re-excised by a BamHI-BglII digest and cloned into the BamHI site of pGSJ780A. The orientation of the insert is antisense relative to the CaMV promoter.
The plasmid contains a neomycin resistance cassette consisting of the Agrobacterium tumefaciens Ti-plasmid nopaline synthase (nos) promoter, the neomycin (neo, nptII) resistance gene, and the A. tumefaciens Ti-plasmid octopine synthase (ocs) terminator, that can be used for selection of transformed plants.
When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide.
The nucleotide sequence of the FeSOD cDNA corresponds with the Genbank accession number NM_118642.2.
EMBL Accession number: NM_118642.2, view at EMBL, GenBank, DDBJ
Latest sequence update: 21/09/2005
Sequence detail:
Primers used to amplify the mature sequence of Arabidopsis thaliana iron 
superoxide dismutase (FeSOD) on pSOD10:

forward:   5' TCAAGTGCTGTAGATCTAAACTACGTCCTC 3'
                         BglII

reverse:   5' ACACACAAAACGGATCCACACTCAGAAAAG 3'
                         BamHI



The nucleotide sequence of the insert:

                          ------------ mature seq. of FeSOD ------------>
                  |       10                                      212
5á ... GCTCATCGGGG|GATCTA.AAC.TAC.GTC.CTC.AAG ... AAG.GCT.GCT.TCT.GCT.TAA
                  |       Asn Tyr Val Leu Lys     Lys Ala Ala Ser Ala +++
             BamHI|BglII fusion


       ---------- 3'UTR of FeSOD --------->   
       GCAAATTTCTGAACA ... CTCTTTTCTGAGTGTGGATCCATCGATTTGT ... 3á
                                          BamHI ClaI

+++: Termination codon.
Punctuation indicates reading frame.
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: BamHI/ClaI, BglII, HindII, HindIII, NdeI, PvuII and SphI.

The PvuII site at position 12550 could not be experimentally confirmed. The compiled nucleotide sequence has not been adapted accordingly.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Prof. Dr D. Inzδ(1) (2) and constructed by W. Van Camp(1) (2).
(1) Department of Plant Systems Biology, VIB, Ghent, Belgium
(2) Department of Plant Systems Biology, Ghent University, Ghent, Belgium
Plasmid reference: -
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061
Host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Related host reference: Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111]
Cultivation medium: LB-Lennox + spectinomycin (150 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

 

New search