GREAT AT SMALL THINGS

GeneCorner plasmid details

Last data update: 20 July 2019 04:16 CEST  


Name: pICOz   Add to cart
Accession number: LMBP 11103
Sequence file: LMBP sequence: p11103.gb, p11103.txt     View with Genome Compiler
Circular map: p11103.pdf
Status: GeneCorner core plasmid
Cloned DNA: -
Promoter: Escherichia coli β-lactamase promoter (amp)
Ribosome
binding site:
Ribosome binding site (RBS) of the Escherichia coli ampicillin resistance gene (amp)
Terminator: -
Selection marker: Bleomycin (bleo; zeomycin (zeo; Zeocin); phleomycin (phleo))
Replicon: Escherichia coli plasmid pMB1 origin; truncated
Host range: Escherichia coli
Parental clone: pUCmu; pCDNA3-zeo
Further information: The plasmid was constructed by PCR amplifying the pUCmu vector backbone without the coding sequence of the ampicillin resistance gene, and PCR amplifying the coding sequence of the zeocin resistance gene from pCDNA3-zeo. The two PCR fragments were subsequently fused with CloneEZ, effectively replacing the ampicillin resistance of pUCmu with zeocin resistance.
pICOz is a minimal cloning plasmid with an extended multiple cloning site.
EMBL Accession number: -
Latest sequence update: 27/08/2018
Sequence detail:
Primers used to amplify the pUCmu backbone without the coding sequence of the ampicillin resistance gene:

forward: 5' ttcgtggccgaggagcaggactgacgtagaaaagatcaaaggatctt 3'
reverse: 5' aacggcactggtcaacttggccatactcttcctttttcaatattat 3'

Primers used to amplify the coding sequence of the zeocin resistance gene:

forward: 5' ataatattgaaaaaggaagagt.ATG.GCC.AAG.TTG.ACC.AGT.GCC.GTT 3'
                                   ***
reverse: 5' aagatcctttgatcttttctacg.TCA.GTC.CTG.CTC.CTC.GGC.CAC.GAA 3'
                                    +++
***: start codon
+++: termination codon
Punctuation indicates reading frame.
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: BglI/HaeII, HindIII and RsaI.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Dr J. Staal(1) (2) and Prof. Dr R. Beyaert(1) (2).
(1) UGent-VIB Center for Inflammation Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: Staal et al., Preprint (2018) [DOI: 10.20944/preprints201807.0287.v2]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 DH5α
Host reference: Focus 8 (1986), 9
Related host reference: Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051]
Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187]
Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791]
Rodriguez-Quinones et al., Focus 15 (1993), 110-112
Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660]
Cultivation medium: LB-Lennox + zeocin (25 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Other culture collection numbers: -

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

 

New search