Last data update: 24 January 2024 16:39 CET
Plasmid name: pICOz (LMBP 11103)
| New search | Print data sheet |
| Price category: | Cat. 3 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
p11103.gb
(View with Genome Compiler) p11103.txt p11103.pdf |
| Sequence analysis results Genecorner: |
NGS: g12-gc-dec2019.fasta |
| Cloned DNA: |
- |
| Promoter: | Escherichia coli β-lactamase promoter (amp) |
| Ribosome binding site: |
Ribosome binding site (RBS) of the Escherichia coli ampicillin resistance gene (amp) |
| Terminator: | - |
| Selection marker: | Bleomycin (bleo; zeomycin (zeo; Zeocin); phleomycin (phleo)) |
| Replicon: | Escherichia coli plasmid pMB1 origin; truncated |
| Host range: | Escherichia coli |
| Parental clone: | pUCmu; pCDNA3-zeo |
| Further information: | The plasmid was constructed by PCR amplifying the pUCmu vector backbone without the coding sequence of the ampicillin resistance gene, and PCR amplifying the coding sequence of the zeocin resistance gene from pCDNA3-zeo. The two PCR fragments were subsequently fused with CloneEZ, effectively replacing the ampicillin resistance of pUCmu with zeocin resistance. pICOz is a minimal cloning plasmid with an extended multiple cloning site. |
| EMBL Accession number: | - |
| Latest sequence update: | 06/04/2020 |
| Sequence detail: | Primers used to amplify the pUCmu backbone without the coding sequence of the ampicillin resistance gene:
forward: 5' ttcgtggccgaggagcaggactgacgtagaaaagatcaaaggatctt 3'
reverse: 5' aacggcactggtcaacttggccatactcttcctttttcaatattat 3'
Primers used to amplify the coding sequence of the zeocin resistance gene:
forward: 5' ataatattgaaaaaggaagagt.ATG.GCC.AAG.TTG.ACC.AGT.GCC.GTT 3'
***
reverse: 5' aagatcctttgatcttttctacg.TCA.GTC.CTG.CTC.CTC.GGC.CAC.GAA 3'
+++
***: start codon
+++: termination codon
Punctuation indicates reading frame. |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: BglI/HaeII, HindIII and RsaI. This plasmid has also been fully sequenced. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Dr J. Staal(1) (2) and Prof. Dr R. Beyaert(1) (2). (1) UGent-VIB Center for Inflammation Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | Staal et al., BioTechniques 66 (2019), 254-259 [PMID: 31124712] [DOI: 10.2144/btn-2019-0014] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 DH5α |
| Host reference: | Focus 8 (1986), 9 |
| Related host reference: | Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
| Cultivation medium: | LB-Lennox + zeocin (25 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pICOz (LMBP 11103) is available at BCCM/GeneCorner. This plasmid was deposited by Dr J. Staal and Prof. Dr R. Beyaert and was published in Staal et al., 2019. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.