Last data update: 24 January 2024 16:39 CET
Plasmid name: pTR10BGal (LMBP 3264)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
p3264.gb
(View with Genome Compiler) p3264.pdf |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Escherichia coli lac Z gene (lacZ); starting at the 9th codon |
| Promoter: | Phage T7 gene 10 promoter (T7g10) |
| Ribosome binding site: |
Ribosome binding site (RBS) of the phage T7 gene 10 (T7g10) Ribosome binding site (RBS) of the Salmonella typhimurium trpA gene |
| Terminator: | Phage fd terminator |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin |
| Host range: | Escherichia coli |
| Parental clone: | pLR10T3; pPLcAT14β-gal; pTrp321 |
| Further information: | The plasmid was constructed as follows: 1) The BamHI (filled in with Klenow DNA polymerase) - PstI fragment from pPLcAT14β-gal, containing the lacZ gene (missing the first 8 codons), was cloned into the KpnI (blunted with Klenow DNA polymerase) - PstI opened pLR10T3 vector; 2) The PstI-EcoRI fragment from this intermediate construction containing the λ-PL promoter was then replaced by the corresponding PstI-EcoRI fragment from pTrp321. Hence, the λ-PL promoter was eliminated. This is an expression vector for soluble β-galactosidase in E. coli under control of the T7 promoter. The high-level expression of the protein is obtained by the system of translational coupling, exploiting the T7g10:Salmonella typhimurium trpB fusion as a short first cistron (CIS1). For T7 driven expression use a strain containing a controllable T7 RNA polymerase gene: preferably a pT7POL plasmid (Mertens et al., Biotechnology 13 (1995), 175-179) or e.g. BL21(DE3). Proceed as follows: first transform auxiliary plasmid, make competent cells again and then transform the expression plasmid. Other name of the plasmid is pTR10βgal. |
| EMBL Accession number: | - |
| Latest sequence update: | 06/09/1996 |
| Sequence detail: | Nucleotide sequence downstream from the T7 promoter:
-- T7 promoter ->
5' ... TAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTT
XbaI
--------------- T7 gene 10 --------------->
1 11
TAAGAAGGAGATATACAT.ATG.GCT.AGC.ATG.ACT.GGT.GGA.CAG.CAA.ATG.GGT
------ NheI
SD1
linker --- lacZ -->
------> ----- S. typhimurium trpB ----> 9 10 11
CGG.ATC.CTG.AAA.GCG.CGA.GGG.GAA.ATC.TGATG.GAT.CCC.GTC.GTT.TTA ... 3'
BamHI -------- +++ BamHI
SD2 ***
SD1: Shine Dalgarno position of the phage T7 gene 10 ribosome binding site.
SD2: Shine Dalgarno position of the Salmonella typhimurium trpA gene.
+++: termination codon of the Salmonella typhimurium trpB gene.
***: start codon of the Salmonella typhimurium trpA gene.
Punctuation indicates reading frame. |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: ClaI and EcoRI. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Prof. Dr E. Remaut(1)(2). It was constructed by N. Mertens(1)(2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | PhD thesis Nico Mertens (1996) |
| Related plasmid reference: | Zabeau et al., EMBO J. 1 (1982), 1217-1224 [PMID: 6327257] Stanssens et al., Gene 36 (1985), 211-223 [PMID: 3000873] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061 |
| Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 28°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pTR10BGal (LMBP 3264) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr E. Remaut and was published in Nico Mertens, 1996. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.