Last data update: 24 January 2024 16:39 CET
Plasmid name: pUCIVHAs (LMBP 3456)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner core plasmid |
| GeneCorner sequence: |
pucivhas.gb
(View with Genome Compiler) pucivhas.pdf |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Influenza A virus (A/Victoria/3/1975(H3N2)) haemagglutinin cDNA (HA, IVHA); N-terminal anchor free |
| Promoter: | Escherichia coli lac operon promoter |
| Ribosome binding site: |
Ribosome binding site (RBS) of the Escherichia coli lac Z gene (lacZ) |
| Terminator: | - |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin |
| Host range: | Escherichia coli |
| Parental clone: | pUC18; pIVHA1si |
| Further information: | The plasmid was constructed by inserting the SalI-BamHI fragment of pIVHA1si (containing the coding sequence for an anchor-free haemagglutinin) into pUC18. The BamHI compatible sticky end, contains translation termination codons in all reading frames and a BamHI and a HpaI restriction site. As such the HA internal BamHI (located at codon 185 in pIVHA1si) is removed and a new BamHI site is created behind the termination codons. The anchor-free haemagglutinin gene contains the signal sequence, the complete HA1 part and codons 1-186 of the HA2 part. When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. |
| EMBL Accession number: | - |
| Latest sequence update: | 13/05/1996 |
| Sequence detail: | Nucleotide sequence at the C-terminus of the IVHAs gene:
186
...TAC.AAA.GAC.TGG.ATC.TAGTTAACTAAGGATCCACTCCT|GGGTAC...
-----------------------------|<-- pUC18
Tyr Lys Asp Trp Ile * * *
HpaI BamHI
linker : 5' GATCTAGTTAACTAAGGATCCACTCCT 3'
3' ATCAATTGATTCCTAGGTGAGGA 5'
* : termination codon |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: AccI, BamHI and HindIII. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by P. Vanlandschoot(1)(2) and Prof. Dr W. Min Jou(1)(2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 DH5α |
| Host reference: | Focus 8 (1986), 9 |
| Related host reference: | Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pUCIVHAs (LMBP 3456) is available at BCCM/GeneCorner. This plasmid was deposited by P. Vanlandschoot and Prof. Dr W. Min Jou. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.