GREAT AT SMALL THINGS

0

GeneCorner plasmid details

Last data update: 24 January 2024 16:39 CET

Plasmid name: pACCMVpLpA (LMBP 4235)

Add to cart

New search Print data sheet
Price category: Cat. 1 (cf. price list)
Status: GeneCorner core plasmid
GeneCorner sequence: p4235.gb (View with Genome Compiler)
p4235.txt
p4235.pdf
Sequence
analysis results
Genecorner:

-

Cloned DNA: Human adenovirus 5 genome (Ad5); fragment
Promoter: Human cytomegalovirus immediate early promoter (CMV-IE) and enhancer
Ribosome
binding site:
-
Terminator: Simian virus 40 polyadenylation signal (SV40 polyA)
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Human adenovirus 5 origin (Ad5)
Host range: Escherichia coli
Mammalian cells
Parental clone: pAC
Further information: The plasmid was derived from pAC by insertion of the human CMV early gene promoter and enhancer, the pUC18 polylinker, and a SV40 fragment including the small t-antigen intron and the polyadenylation signal.
This adenoviral shuttle plasmid was designed to directly accept cDNA fragments for high-level expression.
It is used in combination with e.g. pJM17 to generate recombinant Ad5 viruses.
The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727333.1.
The nucleotide sequence of the Ad5 DNA corresponds with the EMBL Nucleotide Sequence Database accession number X02996.1.
Other name of the plasmid is pLpa.
EMBL Accession number: X02996.1, view at EMBL, GenBank, DDBJ
LT727333.1, view at EMBL, GenBank, DDBJ
Latest sequence update: 31/07/2001
Sequence detail:
Nucleotide sequence of the polylinker:

5' GAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTT 3'
   EcoRI HgiJII    SmaI BamHI XbaI  HindII      SphI  HindIII
   ApoI  SacI  KpnI                 AccI  PstI  
                   AvaI             SalI Sse8387I
                                        BspMI
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: AvaI, BamHI, BglI, BglII, BstZI/SpeI, EcoRI, HincII, HindIII, KpnI, NotI, SalI, SpeI and XbaI.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Dr B. De Geest(1).
(1) Department of Transgene Technology and Gene Therapy, KUL, Leuven, Belgium
Plasmid reference: Gomez-Foix et al., J. Biol. Chem. 267 (1992), 25129-25134 [PMID: 1334082]
Related plasmid reference: De Geest et al., Hum. Gene Ther. 11 (2000), 101-112 [PMID: 10646643]
Becker et al., Methods Cell Biol. 43 (1994), 161-189 [PMID: 7823861]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061
Host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Related host reference: Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Refer in your Materials and Methods:

pACCMVpLpA (LMBP 4235) is available at BCCM/GeneCorner. This plasmid was deposited by Dr B. De Geest and was published in Gomez-Foix et al., 1992.

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search