Last data update: 24 January 2024 16:39 CET
Plasmid name: pAS2hA20R562A (LMBP 3771)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner core plasmid |
GeneCorner sequence: |
p3771.gb
(View with Genome Compiler) p3771.pdf |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Human TNF alpha induced protein 3 cDNA (TNFAIP3, A20, OTUD7C, GeneID 7128) Saccharomyces cerevisiae GAL4 DNA-binding domain (GALbd) Influenza HA epitope encoding the haemagglutinin tagging peptide; N-terminal |
Promoter: | Saccharomyces cerevisiae alcohol dehydrogenase promoter (ADH1) Escherichia coli lac operon promoter |
Ribosome binding site: |
- |
Terminator: | Saccharomyces cerevisiae alcohol dehydrogenase terminator (ADH1) Saccharomyces cerevisiae iso-1-cytochrome C terminator (CYC1) Saccharomyces cerevisiae 2 micron plasmid (2μ) FLP terminator |
Selection marker: | Ampicillin (amp) Cycloheximide (CYH2) TRP1; auxotrophic |
Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin Saccharomyces cerevisiae 2 micron plasmid origin (2μ); incl. region conferring stability (STB) |
Host range: | Escherichia coli Saccharomyces cerevisiae; trp1(-) |
Parental clone: | pAS2A20 |
Further information: | The plasmid was constructed by site-specific mutagenesis of the human zinc finger protein A20 coding sequence (hA20) by the use of primers. As a result, the arginine codon at position 562 was replaced by an alanine codon, creating an additional NheI site. The S. cerevisiae GALbd domain is composed of the first 147 codons from GAL4, containing the nuclear localization signal. hA20R562A does not interact with 14-3-3 proteins. The GALbd-HA-hA20R562A fusion protein can be used as a bait protein in two-hybrid screening. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727381.1. The nucleotide sequence of the pAS2 vector corresponds with the EMBL Nucleotide Sequence Database accession number U30496.1, but adapted as follows: 1) the 'N' nucleotide was removed, restoring the coding sequence of cycloheximide; 2) the sequence GATTTC between GALbd and the HA epitope was replaced by GAATTC, an EcoRI site that has been experimentally confirmed in pAS2; 3) the sequence TTCGAA (Csp45I site) in the ADH1 promoter was replaced by TCGAAG, eliminating the Csp45I site that could not be experimentally confirmed in pAS2. The nucleotide sequence of the hA20 coding sequence corresponds with the Genbank accession number M59465.1. Other name of the plasmid is pAS2HuA20R562A. |
EMBL Accession number: | M59465.1, view at EMBL, GenBank, DDBJ LT727381.1, view at EMBL, GenBank, DDBJ |
Latest sequence update: | 04/02/2004 |
Sequence detail: | Mutator oligonucleotide used: 5' CCTTCCTGTCACCAGGCTAGCAAGTCAGATCCC 3' NheI The nucleotide sequence of the fusion gene: ------------------ GALbd -----------------> 5' ... CTGAAAG.ATG.AAG.CTA.CTG.TCT ... CAG.TTG.ACT.GTA.TCG.CCG.GAA.TTC.ATG.GCT. Met Lys Leu Leu Ser Gln Leu Thr Val Ser Pro Glu Phe Met Ala *** EcoRI ----------- HA epitope -----------> --------------- TAC.CCA.TAC.GAT.GTT.CCA.GAT.TAC.GCT.AGC.TTG.GGT.GGT.CAT.ATG.GCT.GAA.CAA Tyr Pro Tyr Asp Val Pro Asp Tyr Ala Ser Leu Gly Gly His Met Ala Glu Gln NheI NdeI ---------------- hA20m -------------------------------> 562 GTC ... CAC.CAG.GCT.AGC.AAG.TCA ... CAG.ATG.TAT.GGC.TAA.CCGGAAA ... 3' Val His Gln Ala Ser Lys Ser Gln Met Tyr Gly +++ NheI ^^ ^^ ***: start codon. +++: termination codon. ^ : mutated nucleotide. Punctuation indicates reading frame. |
Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: AflIII, BglII and SphI. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Prof. Dr R. Beyaert(1)(2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | De Valck et al., Biochem. Biophys. Res. Commun. 238 (1997), 590-594 [PMID: 9299557] |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 DH5α |
Host reference: | Focus 8 (1986), 9 |
Related host reference: | Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pAS2hA20R562A (LMBP 3771) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr R. Beyaert and was published in De Valck et al., 1997. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.