Last data update: 24 January 2024 16:39 CET
Plasmid name: pAS2mproCASP8-p20p10wt (LMBP 4299)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner non-core plasmid |
Depositor's sequence: | p4299.gb |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Mouse cysteinyl aspartate specific proteinase 8 cDNA (caspase-8, CASP-8, Casp8, MCH5, MACH, FLICE) Saccharomyces cerevisiae GAL4 DNA-binding domain (GALbd) Influenza HA epitope encoding the haemagglutinin tagging peptide; N-terminal |
Promoter: | Saccharomyces cerevisiae alcohol dehydrogenase promoter (ADH1) Escherichia coli lac operon promoter |
Ribosome binding site: |
- |
Terminator: | Saccharomyces cerevisiae alcohol dehydrogenase terminator (ADH1) Saccharomyces cerevisiae iso-1-cytochrome C terminator (CYC1) Saccharomyces cerevisiae 2 micron plasmid (2μ) FLP terminator |
Selection marker: | Ampicillin (amp) Cycloheximide (CYH2) TRP1; auxotrophic |
Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin Saccharomyces cerevisiae 2 micron plasmid origin (2μ); incl. region conferring stability (STB) |
Host range: | Escherichia coli Saccharomyces cerevisiae; trp1(-) |
Parental clone: | pAS2 |
Further information: | The plasmid was created by PCR amplifying the mouse proCASP8 coding sequence and ligating it as an NcoI-SalI fragment into the NcoI-SalI opened pAS2 vector. pAS2 is a yeast two-hybrid vector, expressing the cloned mouse proCASP8 coding sequence as a fusion protein with GAL4DBD. The nucleotide sequence of the pAS2 vector corresponds with the EMBL Nucleotide Sequence Database accession number U30496.1, but adapted as follows: 1) the 'N' nucleotide was removed, restoring the coding sequence of cycloheximide; 2) the sequence GATTTC between GALbd and the HA epitope was replaced by GAATTC, an EcoRI site that has been experimentally confirmed in pAS2; 3) the sequence TTCGAA (Csp45I site) in the ADH1 promoter was replaced by TCGAAG, eliminating the Csp45I site that could not be experimentally confirmed in pAS2. |
EMBL Accession number: | U30496.1, view at EMBL, GenBank, DDBJ |
Latest sequence update: | 21/04/2009 |
Sequence detail: | Primers used to amplify the mouse proCASP8 coding sequence: Forward: 5' CCGCCATGGCCAGTGAGTCACGGACTTCAGACA NcoI Reverse: 5' GCGGGTCGACTTCTCA.TTA.GGG.AGG.GAA.GAA.GAG SalI +++ +++: Termination codon |
Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Prof. Dr P. Vandenabeele(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | - |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 MC1061 |
Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Cultivation remark: | #4 |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pAS2mproCASP8-p20p10wt (LMBP 4299) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr P. Vandenabeele . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.