GREAT AT SMALL THINGS

0

GeneCorner plasmid details

Last data update: 24 January 2024 16:39 CET

Plasmid name: pATHIFNBg41 (LMBP 1660)

Add to cart

New search Print data sheet
Price category: Cat. 1 (cf. price list)
Status: GeneCorner core plasmid
GeneCorner sequence: p1660.gb (View with Genome Compiler)
p1660.pdf
Sequence
analysis results
Genecorner:

-

Cloned DNA: Human interferon β gene (IFNB, IFNB1)
Promoter: Human interferon β promoter (IFNB)
Ribosome
binding site:
-
Terminator: -
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Host range: Escherichia coli
Parental clone: pAT153; pBRHIFNBg41
Further information: This plasmid was derived from pBRHIFNBg41 by exchanging the pBR325 EcoRI-HindIII vector fragment with the EcoRI-HindIII vector fragment from pAT153. This removed the poison sequences present on pBR325.
The plasmid contains the genomic human interferon β gene (hIFNB) with 3' and 5' flanks, but contains no introns.
The tetracycline resistance gene is presumably not biologically active.
The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727581.1.
Other names of the plasmid are pg4delH-NP and pAT153gHIFNB1.
EMBL Accession number: LT727581.1, view at EMBL, GenBank, DDBJ
Latest sequence update: 26/03/1992
Sequence detail:
Nucleotide sequence around the termination codon of the hIFNB gene:


5' GGTTACCTCCGAAACTGA AGATCTCCTAGCCTGTGCCTCTGG 3'
   BstEII         *   BglII            MnlI


*: Termination codon of the hIFNB gene.
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: BglII/EcoRV, EcoRI, EcoRI/HindIII and HindII.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by J. Tavernier(1) and Prof. Dr E. Remaut(1).
(1) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: -
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061
Host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Related host reference: Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Refer in your Materials and Methods:

pATHIFNBg41 (LMBP 1660) is available at BCCM/GeneCorner. This plasmid was deposited by J. Tavernier and Prof. Dr E. Remaut.

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search