Last data update: 24 January 2024 16:39 CET
Plasmid name: pATHIFNBg41 (LMBP 1660)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner core plasmid |
GeneCorner sequence: |
p1660.gb
(View with Genome Compiler) p1660.pdf |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Human interferon β gene (IFNB, IFNB1) |
Promoter: | Human interferon β promoter (IFNB) |
Ribosome binding site: |
- |
Terminator: | - |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin |
Host range: | Escherichia coli |
Parental clone: | pAT153; pBRHIFNBg41 |
Further information: | This plasmid was derived from pBRHIFNBg41 by exchanging the pBR325 EcoRI-HindIII vector fragment with the EcoRI-HindIII vector fragment from pAT153. This removed the poison sequences present on pBR325. The plasmid contains the genomic human interferon β gene (hIFNB) with 3' and 5' flanks, but contains no introns. The tetracycline resistance gene is presumably not biologically active. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727581.1. Other names of the plasmid are pg4delH-NP and pAT153gHIFNB1. |
EMBL Accession number: | LT727581.1, view at EMBL, GenBank, DDBJ |
Latest sequence update: | 26/03/1992 |
Sequence detail: | Nucleotide sequence around the termination codon of the hIFNB gene: 5' GGTTACCTCCGAAACTGA AGATCTCCTAGCCTGTGCCTCTGG 3' BstEII * BglII MnlI *: Termination codon of the hIFNB gene. |
Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: BglII/EcoRV, EcoRI, EcoRI/HindIII and HindII. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by J. Tavernier(1) and Prof. Dr E. Remaut(1). (1) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | - |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 MC1061 |
Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Cultivation remark: | - |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pATHIFNBg41 (LMBP 1660) is available at BCCM/GeneCorner. This plasmid was deposited by J. Tavernier and Prof. Dr E. Remaut. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.