GeneCorner plasmid details

Last data update: 30 July 2021 10:22 CEST

Plasmid name: pATcE6Hy3 (LMBP 2192)

Add to cart

New search Print data sheet
Price category: Cat. 1 (cf. price list)
Status: GeneCorner core plasmid
GeneCorner sequence: (View with Genome Compiler)
analysis results


Cloned DNA: Mouse anti-hPLAP monoclonal antibody E6(Hy3,κ) cDNA; mouse::human chimeric heavy chain (E6Hy3)
Promoter: -
binding site:
Terminator: -
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Host range: Escherichia coli
Parental clone: pATcgE6Hy3
Further information: The plasmid was constructed as follows: 1) Via site-specific mutagenesis, using the linker 'GGACAAGAGAGTTGAGCTCAGGCCAGCGCAGGG', a SacI site was created directly behind the CH1 domain of pATcgE6Hy3; 2) The last intron of pATcgE6Hy3 (between CH1 and H1) was then deleted by a SacI digestion (the second SacI site is located right at the start of the hinge region).
The chimeric CH1 domain contains 60 amino acids of mouse (E6H) and 37 amino acids of human (hIG3) origin.
This plasmid resembles pATE6Hy3, but contains a complete cDNA insert of the heavy chain of E6(Hy3,κ).
The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727631.1.
The SacI-NsiI fragment of pOMMB (located between nucleotide 752 and 1531) was obtained from Genbank 'Release 55; Locus: HUMIGHAF' and differs in 6 nucleotides from the nucleotide sequence of the coding regions of the E6Hy3 SacI-NsiI fragment of pATE6Hy3. The unknown nucleotides in the Genbank-obtained sequence have been sequenced (Dr R. Schoonjans, Department of Biomedical Molecular Biology, Ghent University, Belgium) and correspond with the nucleotides of the genomic E6Hy3 fragment of pATE6Hy3.
EMBL Accession number: J00231, view at EMBL, GenBank, DDBJ
LT727631.1, view at EMBL, GenBank, DDBJ
Latest sequence update: 22/01/1997
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: EcoRI, HindII, SacI and XmnI.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Dr K. De Sutter(1).
(1) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: -
Related plasmid reference: Alexander et al., Proc. Natl. Acad. Sci. U.S.A. 79 (1982), 3260-3264 [PMID: 6808505]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12xB HB101
Host reference: Boyer and Roulland-Dussoix, J. Mol. Biol. 41 (1969), 459-472 [PMID: 4896022]
Related host reference: Sambrook et al. (eds), Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY (1989) [ISSN/ISBN: 0879693096]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Refer in your Materials and Methods:

pATcE6Hy3 (LMBP 2192) is available at BCCM/GeneCorner. This plasmid was deposited by Dr K. De Sutter.

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search