Last data update: 12 April 2021 09:56 CEST
Plasmid name: pATcgE6Hy3 (LMBP 2151)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner non-core plasmid |
Depositor's sequence: | p2151.gb |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Mouse anti-hPLAP monoclonal antibody E6(Hy3,κ) half genomic gene; mouse::human chimeric heavy chain (E6Hy3) |
Promoter: | - |
Ribosome binding site: |
- |
Terminator: | - |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin |
Host range: | Escherichia coli |
Parental clone: | pATE6Hy3; pOMMB |
Further information: | As compared to pATcE6Hy3, this plasmid still contains an intron between the CH1 domain and the hinge region. To construct this plasmid, the genomic human part of the E6Hy3 gene of pATE6Hy3 was substituted, after a SacI-NsiI digestion, by the SacI-NsiI fragment of pOMMB, containing cDNA information of the human γ3 heavy chain. The chimeric CH1 domain contains 60 amino acids of mouse (E6H) origin and 37 amino acids of human γ3 origin. The nucleotide sequence of the SacI-NsiI fragment of pOMMB was obtained from Genbank 'Release 55; Locus : HUMIGHAF' and differs in 6 nucleotides from the sequence of the coding regions of the E6Hy3 SacI-NsiI fragment of pATE6Hy3. The unknown nucleotides in the Genbank-obtained sequence have been sequenced (Dr R. Schoonjans and K. De Sutter, Department of Biomedical Molecular Biology, Ghent University, Belgium). |
EMBL Accession number: | J00231, view at EMBL, GenBank, DDBJ |
Latest sequence update: | 14/03/1996 |
Sequence detail: | Nucleotide sequence at the SacI site: 5' AGATCTGAGTAACTCCCAATCTTCTCTCTGCA GAG.CTC.AAA.ACC.CCA.CTT. 3' BglII * + PstI SacI *: End intron. +: Start of the hinge region. Punctuation indicates reading frame. |
Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Dr K. De Sutter(1). (1) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | - |
Related plasmid reference: | Alexander et al., Proc. Natl. Acad. Sci. U.S.A. 79 (1982), 3260-3264 [PMID: 6808505] |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 MC1061 |
Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pATcgE6Hy3 (LMBP 2151) is available at BCCM/GeneCorner. This plasmid was deposited by Dr K. De Sutter. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.