GREAT AT SMALL THINGS

0

GeneCorner plasmid details

Last data update: 30 November 2020 04:30 CET

Plasmid name: pBBR-exoS (LMBP 5157)

Add to cart

New search

Price category: Cat. 1 (cf. price list)
Status: GeneCorner core plasmid
GeneCorner sequence: p5157.gb (View with Genome Compiler)
p5157.txt
p5157.pdf
Sequence
analysis results
Genecorner:

-

Cloned DNA: Pseudomonas aeruginosa PAO1 exoenzyme S cDNA (exoS)
Histidine tag (His-tag); C-terminal
Bordetella bronchiseptica S87 plasmid pBBR1 mobilisation gene (mob); with modified 3' end
Promoter: Pseudomonas aeruginosa PAO1 exoenzyme S promoter (exoS)
Escherichia coli lac operon promoter
Phage T3 promoter
Phage T7 gene 10 promoter (T7g10)
Ribosome
binding site:
-
Terminator: -
Selection marker: Chloramphenicol (cam)
Replicon: Broad-host-range Gram-negative Bordetella bronchiseptica S87 plasmid pBBR1 replicon
Host range: Escherichia coli
Gram-negative bacterial strains
Parental clone: pBBR1MCS
Further information: The plasmid was constructed by inserting a 1605 bp XbaI-BamHI amplicon, containing the P. aeruginosa exoS promoter and the exoS cds in frame with the C-terminal His-tag, into the XbaI-BamHI opened pBBR1MCS vector.
This is a bacterial expression vector for P. aeruginosa ExoS under control of the endogenous exoS promoter.
ExoS is a Type III secretion system (T3SS) effector protein.
Introduce the plasmid by electroporation, or through conjugation, using plasmid RK2/RP4 transfer functions (provided in trans by RK2/RP4, RK2/RP4-derived vectors, other replicons carrying RK2/RP4 transfer functions (e.g. pRK2073) or strains expressing the tra genes of RK2/RP4).
The nucleotide sequence of the pBBR1MCS vector corresponds with the EMBL Nucleotide Sequence Database accession number U02374.1.
The nucleotide sequence of the wt mob gene corresponds with the EMBL Nucleotide Sequence Database accession number U02374.1 and with the EMBL nucleotide sequence Database accession number X66730.1.
The nucleotide sequence of the exoS cDNA corresponds with the EMBL Nucleotide Sequence Database accession number AE004091.2.
Other name of the plasmid is pBBR1MCS-promotorExoS GAP+/ADPRT+.
EMBL Accession number: U02374.1, view at EMBL, GenBank, DDBJ
X66730.1, view at EMBL, GenBank, DDBJ
AE004091.2, view at EMBL, GenBank, DDBJ
Latest sequence update: 13/08/2008
Sequence detail:
Primers used to amplify the wild-type exoS insert:

forward: 5' GCGTCTAGATGGTGGATGGCGGCGCGGTAGAGTGGATTC 3'
               XbaI  
                                                  453         450                 445
reverse: 5' GCGGGATCC.TCA.GTG.ATG.GTG.ATG.GTG.ATG.GGC.CAG.ATC.AAG.GCC.GCG.CAT.CCT.CAG.G 3'
               BamHI  +++ <------ His-tag ------- <--------------- exoS ----------------

+++: termination codon.
Punctuation indicates reading frame.
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: BamHI/XbaI, BglI, MlsI/PvuI, NcoI and PstI.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by M. Haegman(1) (2) and Prof. Dr R. Beyaert(1) (2).
(1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: Galle et al., J. Cell. Mol. Med. 12 (2008), 1767-1776 [PMID: 18081695]
Related plasmid reference: Antoine et al., Mol. Microbiol. 6 (1992), 1785-1799 [PMID: 1321324]
Kovach et al., BioTechniques 16 (1994), 800-802 [PMID: 8068328]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061
Host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Related host reference: Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111]
Cultivation medium: LB-Lennox + chloramphenicol (25 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Refer in your Materials and Methods:

pBBR-exoS (LMBP 5157) is available at BCCM/GeneCorner. This plasmid was deposited by M. Haegman and Prof. Dr R. Beyaert and was published in Galle et al., 2008.

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search