Last data update: 24 January 2024 16:39 CET
Plasmid name: pBBR-exoS-GAPmin (LMBP 5159)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner non-core plasmid |
Depositor's sequence: | p5159.gb |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Pseudomonas aeruginosa PAO1 exoenzyme S cDNA (exoS); with mutation in the GAP domain Histidine tag (His-tag); C-terminal |
Promoter: | Pseudomonas aeruginosa PAO1 exoenzyme S promoter (exoS) Escherichia coli lac operon promoter Phage T3 promoter Phage T7 gene 10 promoter (T7g10) |
Ribosome binding site: |
- |
Terminator: | - |
Selection marker: | Chloramphenicol (cam) |
Replicon: | Broad-host-range Gram-negative Bordetella bronchiseptica S87 plasmid pBBR1 replicon |
Host range: | Escherichia coli Gram-negative bacterial strains |
Parental clone: | pBBR1MCS |
Further information: | The plasmid was constructed by inserting a 1605 bp XbaI-BamHI fragment, containing the P. aeruginosa exoS promoter and the mutated exoS coding sequence in phase with the C-terminal His-tag, into the XbaI-BamHI opened pBBR1MCS vector. As compared to the wt exoS cDNA, the arginine (R) codon at position 146 was replaced by a lysine (K) codon. This is a bacterial expression vector for exoS, lacking GAP activity, under control of the endogenous exoS promoter. Introduce the plasmid by electroporation, or through conjugation, using plasmid RK2/RP4 transfer functions (provided in trans by RK2/RP4, RK2/RP4-derived vectors, other replicons carrying RK2/RP4 transfer functions (e.g. pRK2073) or strains expressing the tra genes of RK2/RP4). The nucleotide sequence of the pBBR1MCS vector corresponds with the EMBL Nucleotide Sequence Database accession number U02374.1. The nucleotide sequence of the wt exoS cDNA was obtained from Genbank (Accession number NC_002516.2). Other name of the plasmid is pBBR1MCS-promotorExoS GAP-/ADPRT+. |
EMBL Accession number: | U02374.1, view at EMBL, GenBank, DDBJ NC_002516.2, view at EMBL, GenBank, DDBJ |
Latest sequence update: | 13/08/2008 |
Sequence detail: | Primers used to amplify the mutated exoS insert: forward: 5' GCGTCTAGATGGTGGATGGCGGCGCGGTAGAGTGGATTC 3' XbaI 453 450 445 reverse: 5' GCGGGATCC.TCA.GTG.ATG.GTG.ATG.GTG.ATG.GGC.CAG.ATC.AAG.GCC.GCG.CAT.CCT.CAG.G 3' BamHI +++ <------ His-tag ------- <------------ exoS mutant ------------ +++: termination codon. Punctuation indicates reading frame. |
Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: BamHI/XbaI, BglI, MlsI/PvuI, NcoI and PstI. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by M. Haegman(1) (2) and Prof. Dr R. Beyaert(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | Galle et al., J. Cell. Mol. Med. 12 (2008), 1767-1776 [PMID: 18081695] |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 MC1061 |
Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
Cultivation medium: | LB-Lennox + chloramphenicol (25 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Cultivation remark: | - |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pBBR-exoS-GAPmin (LMBP 5159) is available at BCCM/GeneCorner. This plasmid was deposited by M. Haegman and Prof. Dr R. Beyaert and was published in Galle et al., 2008. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.