GREAT AT SMALL THINGS

0

GeneCorner plasmid details

Last data update: 29 October 2020 04:15 CET

Plasmid name: pBBR-exoS-GAPminADPRTmin (LMBP 5160)

Add to cart

New search

Price category: Cat. 1 (cf. price list)
Status: GeneCorner non-core plasmid
Depositor's sequence: p5160.gb
Sequence
analysis results
Genecorner:

-

Cloned DNA: Pseudomonas aeruginosa PAO1 exoenzyme S cDNA (exoS); with mutation in the GAP domain and in the ADPRT domain
Histidine tag (His-tag); C-terminal
Promoter: Pseudomonas aeruginosa PAO1 exoenzyme S promoter (exoS)
Escherichia coli lac operon promoter
Phage T3 promoter
Phage T7 gene 10 promoter (T7g10)
Ribosome
binding site:
-
Terminator: -
Selection marker: Chloramphenicol (cam)
Replicon: Broad-host-range Gram-negative Bordetella bronchiseptica S87 plasmid pBBR1 replicon
Host range: Escherichia coli
Gram-negative bacterial strains
Parental clone: pBBR1MCS
Further information: The plasmid was constructed by inserting a 1605 bp XbaI-BamHI fragment, containing the P. aeruginosa exoS promoter and the mutated exoS coding sequence in phase with the C-terminal His-tag, into the XbaI-BamHI opened pBBR1MCS vector.
This is a bacterial expression vector for exoS, lacking GAP and ADPRT activity, under control of the endogenous exoS promoter.
Introduce the plasmid by electroporation, or through conjugation, using plasmid RK2/RP4 transfer functions (provided in trans by RK2/RP4, RK2/RP4-derived vectors, other replicons carrying RK2/RP4 transfer functions (e.g. pRK2073) or strains expressing the tra genes of RK2/RP4).
As compared to the wt exoS cDNA, the arginine (R) codon at position 146 was replaced by a lysine (K) codon and the glutamic acid (E) codon at position 381 was replaced by an aspartic acid (D) codon. The publication describes, however, a E381A mutation but for the compilation of the nucleotide sequence file we followed the sequence analysis results of the Department of Biomedical Molecular Biology (Ghent University, Belgium).
The nucleotide sequence of the pBBR1MCS vector corresponds with the EMBL Nucleotide Sequence Database accession number U02374.1.
The nucleotide sequence of the wt exoS cDNA was obtained from Genbank (Accession number NC_002516.2).
Other name of the plasmid is pBBR1MCS-promotorExoS GAP-/ADPRT-.
EMBL Accession number: U02374.1, view at EMBL, GenBank, DDBJ
NC_002516.2, view at EMBL, GenBank, DDBJ
Latest sequence update: 13/08/2008
Sequence detail:
Primers used to amplify the mutated exoS insert:

forward: 5' GCGTCTAGATGGTGGATGGCGGCGCGGTAGAGTGGATTC 3'
               XbaI
                                                  453         450                 445
reverse: 5' GCGGGATCC.TCA.GTG.ATG.GTG.ATG.GTG.ATG.GGC.CAG.ATC.AAG.GCC.GCG.CAT.CCT.CAG.G 3'
               BamHI  +++ <------ His-tag ------- <------------ exoS mutant ------------

+++: termination codon.
Punctuation indicates reading frame.
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: BamHI/XbaI, BglI, MlsI/PvuI, NcoI and PstI.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by M. Haegman(1) (2) and Prof. Dr R. Beyaert(1) (2).
(1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: Galle et al., J. Cell. Mol. Med. 12 (2008), 1767-1776 [PMID: 18081695]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061
Host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Related host reference: Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111]
Cultivation medium: LB-Lennox + chloramphenicol (25 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Refer in your Materials and Methods:

pBBR-exoS-GAPminADPRTmin (LMBP 5160) is available at BCCM/GeneCorner. This plasmid was deposited by M. Haegman and Prof. Dr R. Beyaert and was published in Galle et al., 2008.

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search