Last data update: 24 January 2024 16:39 CET
Plasmid name: pBRgHIL6IILfL (LMBP 2992)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | not available |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Human interleukin 6 genomic DNA (IL6, IL-6, IFNB2, BSF2, GeneID 3569); fragment |
| Promoter: | - |
| Ribosome binding site: |
- |
| Terminator: | - |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin |
| Host range: | Escherichia coli |
| Parental clone: | pBRgHIL6IIL; BRcHIL6f |
| Further information: | The plasmid was constructed by isolating exon 5 and the 3' UTR of human IL6 and as an XbaI-PvuI fragment from pBRcHIL6f1 and ligating it into the PstI-PvuI opened vector, together with a PstI-XbaI linker to fuse exons 4 and 5 of human IL6. |
| EMBL Accession number: | - |
| Latest sequence update: | 20/08/2013 |
| Sequence detail: | Nucleotide sequence of the PstI-XbaI linker: 5' CTGCAGAAAAAGGCAAAGAATCTAGA 3' PstI XbaI |
| Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Prof. Dr R. Beyaert(1) (2). It was constructed in the research unit of Em. Prof. Dr G. Haegeman(2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061 |
| Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
| Cultivation medium: | LB-Lennox + tetracycline (10 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pBRgHIL6IILfL (LMBP 2992) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr R. Beyaert . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.