GREAT AT SMALL THINGS

0

GeneCorner plasmid details

Last data update: 22 October 2020 04:25 CEST

Plasmid name: pBRgHIL6IILfL (LMBP 2992)

Add to cart

New search

Price category: Cat. 1 (cf. price list)
Status: GeneCorner non-core plasmid
Depositor's sequence: not available
Sequence
analysis results
Genecorner:

-

Cloned DNA: Human interleukin 6 genomic DNA (IL6); fragment
Promoter: -
Ribosome
binding site:
-
Terminator: -
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Host range: Escherichia coli
Parental clone: pBRgHIL6IIL; BRcHIL6f
Further information: The plasmid was constructed by isolating exon 5 and the 3' UTR of human IL6 and as an XbaI-PvuI fragment from pBRcHIL6f1 and ligating it into the PstI-PvuI opened vector, together with a PstI-XbaI linker to fuse exons 4 and 5 of human IL6.
EMBL Accession number: -
Latest sequence update: 20/08/2013
Sequence detail:
Nucleotide sequence of the PstI-XbaI linker:

5' CTGCAGAAAAAGGCAAAGAATCTAGA 3'
   PstI                XbaI
Authenticity test: The plasmid still needs to be subjected to the authenticity test.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Prof. Dr R. Beyaert(1) (2). It was constructed in the research unit of Em. Prof. Dr G. Haegeman(2).
(1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: -
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061
Host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Related host reference: Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111]
Cultivation medium: LB-Lennox + tetracycline (10 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Refer in your Materials and Methods:

pBRgHIL6IILfL (LMBP 2992) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr R. Beyaert .

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search