GREAT AT SMALL THINGS

0

GeneCorner plasmid details

Last data update: 20 October 2020 04:14 CEST

Plasmid name: pBlu-gA-I (LMBP 4237)

Add to cart

New search

Price category: Cat. 1 (cf. price list)
Status: GeneCorner non-core plasmid
Depositor's sequence: p4237.gb
Sequence
analysis results
Genecorner:

-

Cloned DNA: Human adenovirus 5 genome (Ad5); fragment
Human apolipoprotein A-I genomic DNA (APOA1)
Promoter: Human cytomegalovirus immediate early promoter (CMV-IE) and enhancer
Ribosome
binding site:
-
Terminator: Simian virus 40 polyadenylation signal (SV40 polyA)
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Human adenovirus 5 origin (Ad5)
Host range: Escherichia coli
Mammalian cells
Parental clone: pACCMVpLpA
Further information: The plasmid was created by isolating the genomic dna from the human apoA1 via PCR and ligating it as an EcoRI-XbaI fragment into the pACCMVpLpA vector.
EMBL Accession number: -
Latest sequence update: 08/12/2009
Sequence detail:
Primers used to amplify genomic apo A-I DNA:

Forward primer: 5' CGATGAATTCAGAGACTGCGAGAAGGAGG
                       EcoRI

Reverse primer: 5' GATTTCTAGAGGGCTCCCCCGGATGT
                       XbaI
Authenticity test: The plasmid still needs to be subjected to the authenticity test.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Dr B. De Geest(1).
(1) Department of Transgene Technology and Gene Therapy, KUL, Leuven, Belgium
Plasmid reference: De Geest et al., Hum. Gene Ther. 11 (2000), 101-112 [PMID: 10646643]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061
Host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Related host reference: Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Refer in your Materials and Methods:

pBlu-gA-I (LMBP 4237) is available at BCCM/GeneCorner. This plasmid was deposited by Dr B. De Geest and was published in De Geest et al., 2000.

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search