Last data update: 18 January 2021 04:24 CET
Plasmid name: pBlu-gA-I (LMBP 4237)
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | p4237.gb |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Human adenovirus 5 genome (Ad5); fragment Human apolipoprotein A-I genomic DNA (APOA1) |
| Promoter: | Human cytomegalovirus immediate early promoter (CMV-IE) and enhancer |
| Ribosome binding site: |
- |
| Terminator: | Simian virus 40 polyadenylation signal (SV40 polyA) |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin Human adenovirus 5 origin (Ad5) |
| Host range: | Escherichia coli Mammalian cells |
| Parental clone: | pACCMVpLpA |
| Further information: | The plasmid was created by isolating the genomic dna from the human apoA1 via PCR and ligating it as an EcoRI-XbaI fragment into the pACCMVpLpA vector. |
| EMBL Accession number: | - |
| Latest sequence update: | 08/12/2009 |
| Sequence detail: | Primers used to amplify genomic apo A-I DNA:
Forward primer: 5' CGATGAATTCAGAGACTGCGAGAAGGAGG
EcoRI
Reverse primer: 5' GATTTCTAGAGGGCTCCCCCGGATGT
XbaI |
| Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Dr B. De Geest(1). (1) Department of Transgene Technology and Gene Therapy, KUL, Leuven, Belgium |
| Plasmid reference: | De Geest et al., Hum. Gene Ther. 11 (2000), 101-112 [PMID: 10646643] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 MC1061 |
| Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
| Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pBlu-gA-I (LMBP 4237) is available at BCCM/GeneCorner. This plasmid was deposited by Dr B. De Geest and was published in De Geest et al., 2000. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.