Last data update: 18 January 2021 04:24 CET
Plasmid name: pBlu-gA-I (LMBP 4237)
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner non-core plasmid |
Depositor's sequence: | p4237.gb |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Human adenovirus 5 genome (Ad5); fragment Human apolipoprotein A-I genomic DNA (APOA1) |
Promoter: | Human cytomegalovirus immediate early promoter (CMV-IE) and enhancer |
Ribosome binding site: |
- |
Terminator: | Simian virus 40 polyadenylation signal (SV40 polyA) |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin Human adenovirus 5 origin (Ad5) |
Host range: | Escherichia coli Mammalian cells |
Parental clone: | pACCMVpLpA |
Further information: | The plasmid was created by isolating the genomic dna from the human apoA1 via PCR and ligating it as an EcoRI-XbaI fragment into the pACCMVpLpA vector. |
EMBL Accession number: | - |
Latest sequence update: | 08/12/2009 |
Sequence detail: | Primers used to amplify genomic apo A-I DNA: Forward primer: 5' CGATGAATTCAGAGACTGCGAGAAGGAGG EcoRI Reverse primer: 5' GATTTCTAGAGGGCTCCCCCGGATGT XbaI |
Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Dr B. De Geest(1). (1) Department of Transgene Technology and Gene Therapy, KUL, Leuven, Belgium |
Plasmid reference: | De Geest et al., Hum. Gene Ther. 11 (2000), 101-112 [PMID: 10646643] |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 MC1061 |
Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Cultivation remark: | - |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pBlu-gA-I (LMBP 4237) is available at BCCM/GeneCorner. This plasmid was deposited by Dr B. De Geest and was published in De Geest et al., 2000. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.