Last data update: 12 April 2021 09:56 CEST
Plasmid name: pBlueBachsGCA1 (LMBP 4487)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner core plasmid |
GeneCorner sequence: |
p4487.gb
(View with Genome Compiler) p4487.txt p4487.pdf |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Human guanylate cyclase 1 soluble subunit alpha 1 cDNA (GUCY1A1, GC-SA3, GUC1A3, GUCY1A3, sGCA1, GeneID 2982) V5 epitope; C-terminal Histidine tag (His-tag); C-terminal Escherichia coli lac Z gene (lacZ); 5' fragment with modified 5' end Autographa californica nuclear polyhedrosis virus (AcNPV) ORF 1629; 3' fragment |
Promoter: | Autographa californica nuclear polyhedrosis virus (AcNPV) polyhedrin promoter (PH) Autographa californica nuclear polyhedrosis virus (AcNPV) EcoRI-T large promoter (ETL) |
Ribosome binding site: |
- |
Terminator: | Simian virus 40 polyadenylation signal (SV40 polyA) |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin |
Host range: | Escherichia coli Insect cells; e.g. Sf9 cells |
Parental clone: | pBlueBac4.5/V5-His-TOPO |
Further information: | The plasmid was constructed by inserting a TaqI amplified PCR fragment, containing the human sGCA1 coding sequence, in the topoisomerase I-activated pBlueBac4.5/V5-His-TOPO vector. The human sGCA1 coding sequence is not in phase with the C-terminal His-tag and V5 epitope. After cotransfection with Bac-N-Blue‚ Linear DNA, the plasmid can be used for human sGCA1 expression in insect cells. The 5' lacZ fragment recombines to the lacZ sequence in the Bac-N-Blue DNA and produces blue recombinant plaques for easy selection. The 3' AcNPV ORF 1629 fragment recombines and restores the essential ORF 1629 for production of viable, recombinant virus. As compared to the wild type coding sequence, the lacZ fragment shows some modifications at the N-terminus, where nucleotide positions 4 to 25 (ACCATGATTACGGATTCACTGG) are replaced with a shorter sequence (ATAGATC; positions 4 to 10); furthermore, silent mutations are present at position 297 (A-> G) and 558 (T->C). The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727224.1. The nucleotide sequence of the human sGCA1 cDNA corresponds with the EMBL Nucleotide Sequence Database accession number U58855.1. Other name of the plasmid is pBlueBac4.5/V5-hsGCAlpha1. |
EMBL Accession number: | U58855.1, view at EMBL, GenBank, DDBJ LT727224.1, view at EMBL, GenBank, DDBJ |
Latest sequence update: | 30/01/2002 |
Sequence detail: | Nucleotide sequence at the 3' end of the human sGCA1 insert: hsGCA1 -----------> ---------- V5 epitope 5' ... TCA.GGA.ATA.GAT.TAG.CAACAAGGGCAATTCGAAGCTTAGGCCTGGTAAGCCTATCCCTAACCCT 690 +++ HindIII --------------------> ---- His-tag ----> CTCCTCGGTCTCGATTCTACGCGTACCGGTCATCATCACCATCACCATTGACGTCTCTAGCTTGGAGTCGAC ... 3' AgeI SalI +++: termination codon. Punctuation indicates reading frame. |
Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: AvaI, HindIII and NcoI/XbaI. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Prof. Dr P. Brouckaert(1) (2). It was constructed by M. Buys(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | - |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 TOP10 |
Host reference: | Invitrogen Instruction Manual |
Related host reference: | Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Cultivation remark: | - |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pBlueBachsGCA1 (LMBP 4487) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr P. Brouckaert . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.