GREAT AT SMALL THINGS

0

GeneCorner plasmid details

Last data update: 24 January 2024 16:39 CET

Plasmid name: pBlueBacmsGCA1 (LMBP 4471)

Add to cart

New search Print data sheet
Price category: Cat. 1 (cf. price list)
Status: GeneCorner core plasmid
GeneCorner sequence: p4471.gb (View with Genome Compiler)
p4471.txt
p4471.pdf
Sequence
analysis results
Genecorner:

-

Cloned DNA: Mouse guanylate cyclase 1 cDNA (Gucy1, GC); soluble form, α1 subunit = α3 subunit (sGucy1a3, sGCA1)
V5 epitope; C-terminal
Histidine tag (His-tag); C-terminal
Escherichia coli lac Z gene (lacZ); 5' fragment with modified 5' end
Autographa californica nuclear polyhedrosis virus (AcNPV) ORF 1629; 3' fragment
Promoter: Autographa californica nuclear polyhedrosis virus (AcNPV) polyhedrin promoter (PH)
Autographa californica nuclear polyhedrosis virus (AcNPV) EcoRI-T large promoter (ETL)
Ribosome
binding site:
-
Terminator: Simian virus 40 polyadenylation signal (SV40 polyA)
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Host range: Escherichia coli
Insect cells; e.g. Sf9 cells
Parental clone: pBlueBac4.5/V5-His-TOPO
Further information: The plasmid was constructed by inserting a TaqI amplified PCR fragment, containing the mouse sGCA1 coding sequence, in the topoisomerase I-activated pBlueBac4.5/V5-His-TOPO vector.
The mouse sGCA1 coding sequence is not in phase with the C-terminal His-tag and V5 epitope.
After cotransfection with Bac-N-Blue‚ Linear DNA, the plasmid can be used for mouse sGCA1 expression in insect cells. The 5' lacZ fragment recombines to the lacZ sequence in the Bac-N-Blue DNA and produces blue recombinant plaques for easy selection. The 3' AcNPV ORF 1629 fragment recombines and restores the essential ORF 1629 for production of viable, recombinant virus.
As compared to the wild type coding sequence, the lacZ fragment shows some modifications at the N-terminus, where nucleotide positions 4 to 25 (ACCATGATTACGGATTCACTGG) are replaced with a shorter sequence (ATAGATC; positions 4 to 10); furthermore, silent mutations are present at position 297 (A-> G) and 558 (T->C).
The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727218.1.
The nucleotide sequence of the mouse sGCA1 cDNA corresponds with the EMBL Nucleotide Sequence Database accession number AF297082.1.
Other name of the plasmid is pBlueBac4.5/V5-msGCAlpha1.
EMBL Accession number: AF297082.1, view at EMBL, GenBank, DDBJ
LT727218.1, view at EMBL, GenBank, DDBJ
Latest sequence update: 10/01/2002
Sequence detail:
Nucleotide sequence at the 3' end of the mouse sGCA1 insert:

       msGCA1  671    |                                                      |<- V5 epitope
5'.TCA.GGG.GTA.GAT.TAG.TGA.GCCACATGCTCTTATGTTTGATGCCTAAGGGCAATTCGAAGCTTAGGCCT|GGTAAGCCTAT
                                                                 HindIII

                             ->|         |<-   His-tag    ->|   
CCCTAACCCTCTCCTCGGTCTCGATTCTACG|CGTACCGGT|CATCATCACCATCACCAT|TGACGTCTCTAGCTTGGAGTCGACAA 3'
                                   AgeI                                        SalI
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: BstXI, EcoRV and SacI.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Prof. Dr P. Brouckaert(1) (2). It was constructed by M. Buys(1) (2).
(1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: -
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 TOP10
Host reference: Instruction Manual (Invitrogen)
Related host reference: Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Refer in your Materials and Methods:

pBlueBacmsGCA1 (LMBP 4471) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr P. Brouckaert .

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search