GREAT AT SMALL THINGS

0

GeneCorner plasmid details

Last data update: 24 October 2020 04:12 CEST

Plasmid name: pBlueBacmsGCA1C239A-C244A (LMBP 4642)

Add to cart

New search

Price category: Cat. 1 (cf. price list)
Status: GeneCorner core plasmid
GeneCorner sequence: p4642.gb (View with Genome Compiler)
p4642.pdf
Sequence
analysis results
Genecorner:

-

Cloned DNA: Mouse guanylate cyclase 1, soluble, alpha 3 cDNA (Gucy1a3, alfa 1 sGC, sGC-alfa1, sGCA1); mutated sequence
Escherichia coli lac Z gene (lacZ); 5' fragment
Autographa californica nuclear polyhedrosis virus (AcNPV) ORF 1629; 3' fragment
V5 epitope; C-terminal
Histidine tag (His-tag); C-terminal
Promoter: Autographa californica nuclear polyhedrosis virus (AcNPV) polyhedrin promoter (PH)
Autographa californica nuclear polyhedrosis virus (AcNPV) EcoRI-T large promoter (ETL)
Ribosome
binding site:
-
Terminator: Simian virus 40 polyadenylation signal (SV40 polyA)
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Host range: Escherichia coli
Insect cells; e.g. Sf9 cells
Parental clone: pBlueBacmsGCA1
Further information: The plasmid was constructed via site-directed mutagenesis of pBlueBacmsGCA1, replacing the cysteine codons at positions 239 and 244 of the mouse Gucy1a3 by alanine codons.
The inserted gene is not in phase with the C-terminal His-tag and V5 epitope.
After cotransfection with Bac-N-Blue‚ Linear DNA the plasmid can be used for expression of mutated msGCA1 in insect cells. The 5' lacZ fragment recombines to the lacZ sequence in the Bac-N-Blue DNA and produces blue recombinant plaques for easy selection, the 3' ORF1629 fragment recombines and restores the essential ORF1629 for production of viable, recombinant virus.
The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727138.1.
The nucleotide sequence of the wild type mouse sGCA1 cDNA corresponds with the EMBL Nucleotide Sequence Database accession number AF297082.1.
EMBL Accession number: AF297082.1, view at EMBL, GenBank, DDBJ
LT727138.1, view at EMBL, GenBank, DDBJ
Latest sequence update: 12/12/2002
Sequence detail:
Sequence of the mutated nucleotides:

                         239                 244
msGCA1 wild type: 5' CCC.TGC.TTC.CGA.AGT.GAC.TGT.ACC.GAG 3'
                     Pro Cys Phe Arg Ser Asp Cys Thr Glu

                         239                 244
mutated msGCA1:  `5' CCC.GCC.TTC.CGA.AGT.GAC.GCT.ACC.GAG 3'
                     Pro Ala Phe Arg Ser Asp Ala Thr Glu

Sequence at the 3' end of the inserted gene:

       msGCA1  671    |                                                      |<- V5
5'.TCA.GGG.GTA.GAT.TAG.TGA.GCCACATGCTCTTATGTTTGATGCCTAAGGGCAATTCGAAGCTTAGGCCTGGTAAGCCTAT
                                                                 HindIII

epitope                      ->|        |<-   His-tag   ->|   
CCCTAACCCTCTCCTCGGTCTCGATTCTACGCGTACCGGTCATCATCACCATCACCATTGACGTCTCTAGCTTGGAGTCGACAA 3'
                                  AgeI                                      SalI
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: BstXI, EcoRV and SacI.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Prof. Dr P. Brouckaert(1)(2) and constructed by M. Buys(1)(2).
(1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: -
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 TOP10
Host reference: Invitrogen Instruction Manual
Related host reference: Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Refer in your Materials and Methods:

pBlueBacmsGCA1C239A-C244A (LMBP 4642) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr P. Brouckaert and constructed by M. Buys.

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search