Last data update: 24 January 2024 16:39 CET
Plasmid name: pBlueBacmsGCA1C239A-C244A (LMBP 4642)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner core plasmid |
GeneCorner sequence: |
p4642.gb
(View with Genome Compiler) p4642.pdf |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Mouse guanylate cyclase 1, soluble, alpha 3 cDNA (Gucy1a3, alfa 1 sGC, sGC-alfa1, sGCA1); mutated sequence Escherichia coli lac Z gene (lacZ); 5' fragment Autographa californica nuclear polyhedrosis virus (AcNPV) ORF 1629; 3' fragment V5 epitope; C-terminal Histidine tag (His-tag); C-terminal |
Promoter: | Autographa californica nuclear polyhedrosis virus (AcNPV) polyhedrin promoter (PH) Autographa californica nuclear polyhedrosis virus (AcNPV) EcoRI-T large promoter (ETL) |
Ribosome binding site: |
- |
Terminator: | Simian virus 40 polyadenylation signal (SV40 polyA) |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin |
Host range: | Escherichia coli Insect cells; e.g. Sf9 cells |
Parental clone: | pBlueBacmsGCA1 |
Further information: | The plasmid was constructed via site-directed mutagenesis of pBlueBacmsGCA1, replacing the cysteine codons at positions 239 and 244 of the mouse Gucy1a3 by alanine codons. The inserted gene is not in phase with the C-terminal His-tag and V5 epitope. After cotransfection with Bac-N-Blue‚ Linear DNA the plasmid can be used for expression of mutated msGCA1 in insect cells. The 5' lacZ fragment recombines to the lacZ sequence in the Bac-N-Blue DNA and produces blue recombinant plaques for easy selection, the 3' ORF1629 fragment recombines and restores the essential ORF1629 for production of viable, recombinant virus. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727138.1. The nucleotide sequence of the wild type mouse sGCA1 cDNA corresponds with the EMBL Nucleotide Sequence Database accession number AF297082.1. |
EMBL Accession number: | AF297082.1, view at EMBL, GenBank, DDBJ LT727138.1, view at EMBL, GenBank, DDBJ |
Latest sequence update: | 12/12/2002 |
Sequence detail: | Sequence of the mutated nucleotides: 239 244 msGCA1 wild type: 5' CCC.TGC.TTC.CGA.AGT.GAC.TGT.ACC.GAG 3' Pro Cys Phe Arg Ser Asp Cys Thr Glu 239 244 mutated msGCA1: `5' CCC.GCC.TTC.CGA.AGT.GAC.GCT.ACC.GAG 3' Pro Ala Phe Arg Ser Asp Ala Thr Glu Sequence at the 3' end of the inserted gene: msGCA1 671 | |<- V5 5'.TCA.GGG.GTA.GAT.TAG.TGA.GCCACATGCTCTTATGTTTGATGCCTAAGGGCAATTCGAAGCTTAGGCCTGGTAAGCCTAT HindIII epitope ->| |<- His-tag ->| CCCTAACCCTCTCCTCGGTCTCGATTCTACGCGTACCGGTCATCATCACCATCACCATTGACGTCTCTAGCTTGGAGTCGACAA 3' AgeI SalI |
Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: BstXI, EcoRV and SacI. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Prof. Dr P. Brouckaert(1)(2) and constructed by M. Buys(1)(2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | - |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 TOP10 |
Host reference: | Instruction Manual (Invitrogen) |
Related host reference: | Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Cultivation remark: | - |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pBlueBacmsGCA1C239A-C244A (LMBP 4642) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr P. Brouckaert and constructed by M. Buys. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.