Last data update: 24 January 2024 16:39 CET
Plasmid name: pBlueBacmsGCA1s (LMBP 4469)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner core plasmid |
GeneCorner sequence: |
p4469.gb
(View with Genome Compiler) p4469.pdf |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Mouse guanylate cyclase 1, soluble, alpha 3 cDNA (Gucy1a3, alfa 1 sGC, sGC-alfa1, sGCA1); splice variant Escherichia coli lac Z gene (lacZ); 5' fragment Autographa californica nuclear polyhedrosis virus (AcNPV) ORF 1629; 3' fragment V5 epitope; C-terminal Histidine tag (His-tag); C-terminal |
Promoter: | Autographa californica nuclear polyhedrosis virus (AcNPV) polyhedrin promoter (PH) Autographa californica nuclear polyhedrosis virus (AcNPV) EcoRI-T large promoter (ETL) |
Ribosome binding site: |
- |
Terminator: | Simian virus 40 polyadenylation signal (SV40 polyA) |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin |
Host range: | Escherichia coli Insect cells; e.g. Sf9 cells |
Parental clone: | pBlueBac4.5/V5-His-TOPO |
Further information: | The plasmid was constructed by inserting a TaqI amplified PCR fragment, containing the splice variant of mouse soluble guanylate cyclase α1 coding sequence (msGCA1) in the topoisomerase I-activated pBlueBac4.5/V5-His-TOPO vector. The inserted gene is not in phase with the C-terminal His-tag and V5 epitope. The codons for amino acids 23 to 216 of the msGCA1are missing. After cotransfection with Bac-N-Blue‚ Linear DNA the plasmid can be used for msGCA1s expression in insect cells. The 5' lacZ fragment recombines to the lacZ sequence in the Bac-N-Blue DNA and produces blue recombinant plaques for easy selection, the 3' ORF1629 fragment recombines and restores the essential ORF1629 for production of viable, recombinant virus. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727216.1. The nucleotide sequence of the msGCA1 cDNA corresponds with the EMBL Nucleotide Sequence Database accession number AF297082.1. Other names of the plasmid are pBlueBac4.5/V5-msGCα1splice and pBlueBacmsGCA1splice. |
EMBL Accession number: | AF297082.1, view at EMBL, GenBank, DDBJ LT727216.1, view at EMBL, GenBank, DDBJ |
Latest sequence update: | 10/01/2002 |
Sequence detail: | Sequence around the deletion in mouse sGCA1s: 20 22|217 220 5' TTA.CTG.GCC.CCT.GGT.ATC.ATT.AAA 3' Leu Leu Ala Pro Gly Ile Ile Lys Sequence at the 3' end of the inserted gene: msGCA1 671 | |<- V5 5'.TCA.GGG.GTA.GAT.TAG.TGA.GCCACATGCTCTTATGTTTGATGCCTAAGGGCAATTCGAAGCTTAGGCCTGGTAAGCCTAT HindIII epitope ->| |<- His-tag ->| CCCTAACCCTCTCCTCGGTCTCGATTCTACGCGTACCGGTCATCATCACCATCACCATTGACGTCTCTAGCTTGGAGTCGACAA 3' AgeI SalI |
Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: EcoRV, HindIII and SacI. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Prof. Dr P. Brouckaert(1)(2) and constructed by M. Buys(1)(2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | - |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 TOP10 |
Host reference: | Instruction Manual (Invitrogen) |
Related host reference: | Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Cultivation remark: | - |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pBlueBacmsGCA1s (LMBP 4469) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr P. Brouckaert and constructed by M. Buys. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.