GREAT AT SMALL THINGS

0

GeneCorner plasmid details

Last data update: 24 January 2024 16:39 CET

Plasmid name: pBlueBacmsGCA1s (LMBP 4469)

Add to cart

New search Print data sheet
Price category: Cat. 1 (cf. price list)
Status: GeneCorner core plasmid
GeneCorner sequence: p4469.gb (View with Genome Compiler)
p4469.pdf
Sequence
analysis results
Genecorner:

-

Cloned DNA: Mouse guanylate cyclase 1, soluble, alpha 3 cDNA (Gucy1a3, alfa 1 sGC, sGC-alfa1, sGCA1); splice variant
Escherichia coli lac Z gene (lacZ); 5' fragment
Autographa californica nuclear polyhedrosis virus (AcNPV) ORF 1629; 3' fragment
V5 epitope; C-terminal
Histidine tag (His-tag); C-terminal
Promoter: Autographa californica nuclear polyhedrosis virus (AcNPV) polyhedrin promoter (PH)
Autographa californica nuclear polyhedrosis virus (AcNPV) EcoRI-T large promoter (ETL)
Ribosome
binding site:
-
Terminator: Simian virus 40 polyadenylation signal (SV40 polyA)
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Host range: Escherichia coli
Insect cells; e.g. Sf9 cells
Parental clone: pBlueBac4.5/V5-His-TOPO
Further information: The plasmid was constructed by inserting a TaqI amplified PCR fragment, containing the splice variant of mouse soluble guanylate cyclase α1 coding sequence (msGCA1) in the topoisomerase I-activated pBlueBac4.5/V5-His-TOPO vector.
The inserted gene is not in phase with the C-terminal His-tag and V5 epitope. The codons for amino acids 23 to 216 of the msGCA1are missing.
After cotransfection with Bac-N-Blue‚ Linear DNA the plasmid can be used for msGCA1s expression in insect cells. The 5' lacZ fragment recombines to the lacZ sequence in the Bac-N-Blue DNA and produces blue recombinant plaques for easy selection, the 3' ORF1629 fragment recombines and restores the essential ORF1629 for production of viable, recombinant virus.
The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727216.1.
The nucleotide sequence of the msGCA1 cDNA corresponds with the EMBL Nucleotide Sequence Database accession number AF297082.1.
Other names of the plasmid are pBlueBac4.5/V5-msGCα1splice and pBlueBacmsGCA1splice.
EMBL Accession number: AF297082.1, view at EMBL, GenBank, DDBJ
LT727216.1, view at EMBL, GenBank, DDBJ
Latest sequence update: 10/01/2002
Sequence detail:
Sequence around the deletion in mouse sGCA1s:

        20      22|217         220 
5' TTA.CTG.GCC.CCT.GGT.ATC.ATT.AAA 3'
   Leu Leu Ala Pro Gly Ile Ile Lys

Sequence at the 3' end of the inserted gene:

       msGCA1  671    |                                                      |<- V5
5'.TCA.GGG.GTA.GAT.TAG.TGA.GCCACATGCTCTTATGTTTGATGCCTAAGGGCAATTCGAAGCTTAGGCCTGGTAAGCCTAT
                                                                 HindIII

epitope                      ->|        |<-   His-tag   ->|   
CCCTAACCCTCTCCTCGGTCTCGATTCTACGCGTACCGGTCATCATCACCATCACCATTGACGTCTCTAGCTTGGAGTCGACAA 3'
                                  AgeI                                      SalI
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: EcoRV, HindIII and SacI.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Prof. Dr P. Brouckaert(1)(2) and constructed by M. Buys(1)(2).
(1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: -
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 TOP10
Host reference: Instruction Manual (Invitrogen)
Related host reference: Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Refer in your Materials and Methods:

pBlueBacmsGCA1s (LMBP 4469) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr P. Brouckaert and constructed by M. Buys.

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search