GREAT AT SMALL THINGS

0

GeneCorner plasmid details

Last data update: 26 October 2020 04:25 CET

Plasmid name: pBluhCASP-6 (LMBP 3814)

Add to cart

New search

Price category: Cat. 1 (cf. price list)
Status: GeneCorner core plasmid
GeneCorner sequence: p3814.gb (View with Genome Compiler)
p3814.pdf
Sequence
analysis results
Genecorner:

-

Cloned DNA: Human cysteinyl aspartate specific proteinase 6 cDNA (caspase-6, hCASP-6, Mch2)
Promoter: Phage T7 gene 10 promoter (T7g10)
Phage T3 promoter
Escherichia coli lac operon promoter
Ribosome
binding site:
-
Terminator: -
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Phage f1 origin
Host range: Escherichia coli
Parental clone: pBluescriptIISK-
Further information: The plasmid was constructed as follows: (I) the coding sequence of human caspase 6 (hCASP-6) was amplified by PCR from the human JURKAT cell line, (ii) the 252 bp EcoRI/BglII fragment of this PCR amplicon was inserted between the EcoRI and BglII sites of EST clone #84689, to fill up the 5'-incomplete hCASP-6 cDNA fragment.
When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide.
The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727398.1.
The nucleotide sequence of hCASP-6 corresponds with the Genbank accession number U20536.1.
Other name of the plasmid is pbluemch2#1.
EMBL Accession number: U20536.1, view at EMBL, GenBank, DDBJ
LT727398.1, view at EMBL, GenBank, DDBJ
Latest sequence update: 20/04/1999
Sequence detail:
forward primer: 5' GCGGAATTCTCGAGCTGCA.ATG.AGC.TCG.GCC.TCG.GG 3'
                           XhoI
                      EcoRI

reverse primer: 5'  GCACCGCGGCCGCATTAGATTTTGGAAAGAAATGCAGC 3'
                         NotI

5' adaptor sequence of the EST clone:  GAATTCGGCACGAG
                                       EcoRI

3' adaptor sequence of the EST clone:  CTCGAGTn
                                       XhoI
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: EcoRI, NotI, RsaI and XhoI.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Prof. Dr P. Vandenabeele(1)(2).
(1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: -
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 DH5α
Host reference: Focus 8 (1986), 9
Related host reference: Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051]
Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187]
Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791]
Rodriguez-Quinones et al., Focus 15 (1993), 110-112
Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Refer in your Materials and Methods:

pBluhCASP-6 (LMBP 3814) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr P. Vandenabeele.

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search