Last data update: 12 April 2021 09:56 CEST
Plasmid name: pBluhCASP-6 (LMBP 3814)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner core plasmid |
GeneCorner sequence: |
p3814.gb
(View with Genome Compiler) p3814.pdf |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Human cysteinyl aspartate specific proteinase 6 cDNA (caspase-6, hCASP-6, Mch2) |
Promoter: | Phage T7 gene 10 promoter (T7g10) Phage T3 promoter Escherichia coli lac operon promoter |
Ribosome binding site: |
- |
Terminator: | - |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin Phage f1 origin |
Host range: | Escherichia coli |
Parental clone: | pBluescriptIISK- |
Further information: | The plasmid was constructed as follows: (I) the coding sequence of human caspase 6 (hCASP-6) was amplified by PCR from the human JURKAT cell line, (ii) the 252 bp EcoRI/BglII fragment of this PCR amplicon was inserted between the EcoRI and BglII sites of EST clone #84689, to fill up the 5'-incomplete hCASP-6 cDNA fragment. When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727398.1. The nucleotide sequence of hCASP-6 corresponds with the Genbank accession number U20536.1. Other name of the plasmid is pbluemch2#1. |
EMBL Accession number: | U20536.1, view at EMBL, GenBank, DDBJ LT727398.1, view at EMBL, GenBank, DDBJ |
Latest sequence update: | 20/04/1999 |
Sequence detail: | forward primer: 5' GCGGAATTCTCGAGCTGCA.ATG.AGC.TCG.GCC.TCG.GG 3' XhoI EcoRI reverse primer: 5' GCACCGCGGCCGCATTAGATTTTGGAAAGAAATGCAGC 3' NotI 5' adaptor sequence of the EST clone: GAATTCGGCACGAG EcoRI 3' adaptor sequence of the EST clone: CTCGAGTn XhoI |
Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: EcoRI, NotI, RsaI and XhoI. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Prof. Dr P. Vandenabeele(1)(2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | - |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 DH5α |
Host reference: | Focus 8 (1986), 9 |
Related host reference: | Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Cultivation remark: | - |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pBluhCASP-6 (LMBP 3814) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr P. Vandenabeele. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.