Last data update: 06 March 2021 04:22 CET
Plasmid name: pCAGGS-E-IDextramMyD88 (LMBP 5229)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner non-core plasmid |
Depositor's sequence: | p5229.gb |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Mouse myeloid differentiation primary response gene 88 cDNA (Myd88, GeneID 17874); fragment including intermediate (ID) domain E-tag; N-terminal |
Promoter: | Chicken β-actin/rabbit β-globin hybrid promoter (AG) Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only Escherichia coli lac operon promoter |
Ribosome binding site: |
- |
Terminator: | Rabbit β-globin polyadenylation signal (β-globin polyA) Simian virus 40 polyadenylation signal (SV40 polyA) |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin Simian virus 40 bidirectional origin (SV40) |
Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
Parental clone: | pCAGGS-E-hPeli 1 |
Further information: | The plasmid was constructed as follows: the intermediate domain of the mouse myeloid differentiation primary response gene 88 cDNA (Myd88) plus 7 codons upstream and 7 codons downstream was amplified by PCR. The resulting fragment was NotI/XhoI digested and ligated in the NotI/XhoI opened pCAGGS-E-hPeli1. The plasmid is useful for highly efficient expression of the fusion gene under the control of the AG promoter and the human CMV-IE enhancer in various mammalian cells. The 14 extra amino acids were introduced to allow better folding of the ID domain in case the ID domain on its own does not allow proper folding. The AG promoter sequence consists of the chicken β-actin promoter, the first exon and part of the first intron (that seems to have a strong enhancer-like activity) linked to a rabbit β-globin fragment, consisting of a 3' part of the second intron (inclusive a branch point which is required for normal splicing reactions) and a 5' part of the third exon. When cloning a fragment downstream from the lac promoter it may be advisable to use lacIq strains in order to prevent fortuitous expression of a possibly noxious polypeptide. The nucleotide sequence of the Myd88 cDNA was obtained from Genbank accession number NM_010851.2. |
EMBL Accession number: | NM_010851.2, view at GenBank |
Latest sequence update: | 26/02/2007 |
Sequence detail: | The primers used in PCR to amplify Myd88 cDNA + 14 extra codons were: forward: 5' AAGGAAAAAAGCGGCCGCGAAGGAGCTGAAGTCGCGCATC 3' NotI reverse: 5' AAAAACCGCTCGAGTCAGAAAAGTTCCGGCGTTTGTCC 3' XhoI |
Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Prof. Dr R. Beyaert(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | - |
Related plasmid reference: | Janssens et al., Trends Biochem. Sci. 27 (2002), 474-482 [PMID: 12217523] |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 MC1061 |
Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Cultivation remark: | - |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pCAGGS-E-IDextramMyD88 (LMBP 5229) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr R. Beyaert . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.