GREAT AT SMALL THINGS

0

GeneCorner plasmid details

Last data update: 24 January 2024 16:39 CET

Plasmid name: pCAGGS-E-IDextramMyD88 (LMBP 5229)

Add to cart

New search Print data sheet
Price category: Cat. 1 (cf. price list)
Status: GeneCorner non-core plasmid
Depositor's sequence: p5229.gb
Sequence
analysis results
Genecorner:

-

Cloned DNA: Mouse myeloid differentiation primary response gene 88 cDNA (Myd88, GeneID 17874); fragment including intermediate (ID) domain
E-tag; N-terminal
Promoter: Chicken β-actin/rabbit β-globin hybrid promoter (AG)
Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only
Escherichia coli lac operon promoter
Ribosome
binding site:
-
Terminator: Rabbit β-globin polyadenylation signal (β-globin polyA)
Simian virus 40 polyadenylation signal (SV40 polyA)
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Simian virus 40 bidirectional origin (SV40)
Host range: Escherichia coli
Mammalian cells; SV40 permissive cells
Parental clone: pCAGGS-E-hPeli 1
Further information: The plasmid was constructed as follows: the intermediate domain of the mouse myeloid differentiation primary response gene 88 cDNA (Myd88) plus 7 codons upstream and 7 codons downstream was amplified by PCR. The resulting fragment was NotI/XhoI digested and ligated in the NotI/XhoI opened pCAGGS-E-hPeli1.
The plasmid is useful for highly efficient expression of the fusion gene under the control of the AG promoter and the human CMV-IE enhancer in various mammalian cells. The 14 extra amino acids were introduced to allow better folding of the ID domain in case the ID domain on its own does not allow proper folding.
The AG promoter sequence consists of the chicken β-actin promoter, the first exon and part of the first intron (that seems to have a strong enhancer-like activity) linked to a rabbit β-globin fragment, consisting of a 3' part of the second intron (inclusive a branch point which is required for normal splicing reactions) and a 5' part of the third exon.
When cloning a fragment downstream from the lac promoter it may be advisable to use lacIq strains in order to prevent fortuitous expression of a possibly noxious polypeptide.
The nucleotide sequence of the Myd88 cDNA was obtained from Genbank accession number NM_010851.2.
EMBL Accession number: NM_010851.2, view at GenBank
Latest sequence update: 26/02/2007
Sequence detail:
The primers used in PCR to amplify Myd88 cDNA + 14 extra codons were:

forward: 5' AAGGAAAAAAGCGGCCGCGAAGGAGCTGAAGTCGCGCATC 3'
                      NotI

reverse: 5' AAAAACCGCTCGAGTCAGAAAAGTTCCGGCGTTTGTCC 3'
                    XhoI
Authenticity test: The plasmid still needs to be subjected to the authenticity test.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Prof. Dr R. Beyaert(1) (2).
(1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: -
Related plasmid reference: Janssens et al., Trends Biochem. Sci. 27 (2002), 474-482 [PMID: 12217523]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061
Host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Related host reference: Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Refer in your Materials and Methods:

pCAGGS-E-IDextramMyD88 (LMBP 5229) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr R. Beyaert .

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search