Last data update: 16 April 2021 10:31 CEST
Plasmid name: pCAGGS-E-IDmMyD88 (LMBP 5228)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner non-core plasmid |
Depositor's sequence: | p5228.gb |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Mouse myeloid differentiation primary response gene 88 cDNA (Myd88, GeneID 17874); intermediate (ID) domain E-tag; N-terminal |
Promoter: | Chicken β-actin/rabbit β-globin hybrid promoter (AG) Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only Escherichia coli lac operon promoter |
Ribosome binding site: |
- |
Terminator: | Rabbit β-globin polyadenylation signal (β-globin polyA) Simian virus 40 polyadenylation signal (SV40 polyA) |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin Simian virus 40 bidirectional origin (SV40) |
Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
Parental clone: | pCAGGS-E-hPeli1 |
Further information: | The plasmid was constructed as follows: the intermediate domain of the mouse myeloid differentiation primary response gene 88 cDNA (Myd88) was amplified by PCR. The resulting fragment was NotI/XhoI digested and ligated in the NotI/XhoI opened pCAGGS-E-hPeli1. The plasmid is useful for highly efficient expression of the fusion gene under the control of the AG promoter and the human CMV-IE enhancer in various mammalian cells. The AG promoter sequence consists of the chicken β-actin promoter, the first exon and part of the first intron (that seems to have a strong enhancer-like activity) linked to a rabbit β-globin fragment, consisting of a 3' part of the second intron (inclusive a branch point which is required for normal splicing reactions) and a 5' part of the third exon. When cloning a fragment downstream from the lac promoter it may be advisable to use lacIq strains in order to prevent fortuitous expression of a possibly noxious polypeptide. The nucleotide sequence of the Myd88 cDNA was obtained from Genbank accession number NM_010851.2. |
EMBL Accession number: | NM_010851.2, view at GenBank |
Latest sequence update: | 23/02/2007 |
Sequence detail: | The primers used in PCR to amplify Myd88 cDNA were: forward: 5' AAGGAAAAAAGCGGCCGCCGAGGAGGACTGCCAGAAATACTTAGG 3' NotI reverse: 5' AAAAACCGCTCGAGTCATAGGGGGTCATCAA 3' XhoI |
Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Prof. Dr R. Beyaert(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | - |
Related plasmid reference: | Janssens et al., Trends Biochem. Sci. 27 (2002), 474-482 [PMID: 12217523] |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 MC1061 |
Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Cultivation remark: | - |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pCAGGS-E-IDmMyD88 (LMBP 5228) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr R. Beyaert . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.