GREAT AT SMALL THINGS

0

GeneCorner plasmid details

Last data update: 24 January 2024 16:39 CET

Plasmid name: pCAGGS-E-MALT1C::GyrB (LMBP 5696)

Add to cart

New search Print data sheet
Price category: Cat. 1 (cf. price list)
Status: GeneCorner non-core plasmid
Depositor's sequence: p5696.gb
Sequence
analysis results
Genecorner:

-

Cloned DNA: Human MALT1 paracaspase cDNA (MALT1, MLT, PCASP1, paracaspase 1, GeneID 10892); fragment
Escherichia coli DNA gyrase subunit B (gyrB); fragment
E-tag; N-terminal
Promoter: Chicken β-actin/rabbit β-globin hybrid promoter (AG)
Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only
Escherichia coli lac operon promoter
Ribosome
binding site:
-
Terminator: Rabbit β-globin polyadenylation signal (β-globin polyA)
Simian virus 40 polyadenylation signal (SV40 polyA)
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Simian virus 40 bidirectional origin (SV40)
Host range: Escherichia coli
Mammalian cells; SV40 permissive cells
Parental clone: pCD-MK; pCAGGS-E-N-hA20gyrB; pCAGGSEhA20
Further information: The plasmid was constructed by PCR amplifying part of the human MALT1 coding sequence from pCD-MK and the E. coli gyraseB dimerization domain from pCAGGS-E-N-hA20gyrB, fusing the coding sequences and cloning them into the NotI/BstXI opened pCAGGSEhA20 vector, replacing the human TNFAIP3 coding sequence.
The plasmid encodes for amino acid residues 334-824 of human MALT1.
EMBL Accession number: -
Latest sequence update: 09/04/2009
Sequence detail:
Primers used for amplifying the GyrB-fragment:

GyrB-F: 5' TCGAATTCTTATGACTCCTCCAG

BstXI-GyrB-R: 5' ctggtgtggccagggcattggcCACACCAGCCACCACCTTCTGATA

Primers used to amplify the MALT1C fragment:

NotI-MALT1C-F: 5' cccgctggaaccgctgcggccgcaACAACTGACCAGCCTTTGG

GyrB-MALT1C-R : 5' CTGGAGGAGTCATAAGAATTCGATTTTTCAGAAATTCTGAGCCTGTC
Authenticity test: The plasmid still needs to be subjected to the authenticity test.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Dr J. Staal(1) (2) and Prof. Dr R. Beyaert(1) (2).
(1) UGent-VIB Center for Inflammation Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: -
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 DH5α
Host reference: Focus 8 (1986), 9
Related host reference: Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660]
Rodriguez-Quinones et al., Focus 15 (1993), 110-112
Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8]
Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187]
Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Other culture collection numbers: -

Refer in your Materials and Methods:

pCAGGS-E-MALT1C::GyrB (LMBP 5696) is available at BCCM/GeneCorner. This plasmid was deposited by Dr J. Staal and Prof. Dr R. Beyaert .

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search