Last data update: 24 January 2024 16:39 CET
Plasmid name: pCAGGS-E-MALT1Cd180::GyrB (LMBP 5698)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner non-core plasmid |
Depositor's sequence: | p5698.gb |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Human MALT1 paracaspase cDNA (MALT1, MLT, PCASP1, paracaspase 1, GeneID 10892); fragment Escherichia coli DNA gyrase subunit B (gyrB); fragment E-tag; N-terminal |
Promoter: | Chicken β-actin/rabbit β-globin hybrid promoter (AG) Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only Escherichia coli lac operon promoter |
Ribosome binding site: |
- |
Terminator: | Rabbit β-globin polyadenylation signal (β-globin polyA) Simian virus 40 polyadenylation signal (SV40 polyA) |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin Simian virus 40 bidirectional origin (SV40) |
Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
Parental clone: | pCD-MK; pCAGGS-E-N-hA20gyrB; pCAGGSEhA20 |
Further information: | The plasmid was constructed by PCR amplifying part of the human MALT1 coding sequence from pCD-MK and the E. coli gyraseB dimerization domain from pCAGGS-E-N-hA20gyrB, fusing the coding sequences and cloning them into the NotI/BstXI opened pCAGGSEhA20 vector, replacing the human TNFAIP3 coding sequence. The plasmid contains amino acid residues 334-664 of human MALT1. |
EMBL Accession number: | - |
Latest sequence update: | 09/04/2009 |
Sequence detail: | Primers used for amplifying the GyrB-fragment: GyrB-F: 5' TCGAATTCTTATGACTCCTCCAG BstXI-GyrB-R: 5' ctggtgtggccagggcattggcCACACCAGCCACCACCTTCTGATA Primers used to amplify the MALT1C fragment: NotI-MALT1C-F: 5' cccgctggaaccgcgtgcggccgcaACAACTGACCAGCCTTTGG GyrB-MALT1Cd180-R : 5' CTGGAGGAGTCATAAGAATTCGAttttggatcaatatctagatcaag |
Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Dr J. Staal(1) (2) and Prof. Dr R. Beyaert(1) (2). (1) UGent-VIB Center for Inflammation Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | - |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 DH5α |
Host reference: | Focus 8 (1986), 9 |
Related host reference: | Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pCAGGS-E-MALT1Cd180::GyrB (LMBP 5698) is available at BCCM/GeneCorner. This plasmid was deposited by Dr J. Staal and Prof. Dr R. Beyaert . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.