GREAT AT SMALL THINGS

0

GeneCorner plasmid details

Last data update: 25 October 2020 04:11 CET

Plasmid name: pCAGGS-E-hA20-R439A-R742A (LMBP 7786)

Add to cart

New search

Price category: Cat. 1 (cf. price list)
Status: GeneCorner non-core plasmid
Depositor's sequence: p7786.gb
Sequence
analysis results
Genecorner:

-

Cloned DNA: Human TNF alpha induced protein 3 cDNA (TNFAIP3, A20, OTUD7C, GeneID 7128); mutated sequence
E-tag; N-terminal
Promoter: Chicken β-actin/rabbit β-globin hybrid promoter (AG)
Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only
Escherichia coli lac operon promoter
Ribosome
binding site:
-
Terminator: Rabbit β-globin polyadenylation signal (β-globin polyA)
Simian virus 40 polyadenylation signal (SV40 polyA)
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Simian virus 40 bidirectional origin (SV40)
Host range: Escherichia coli
Mammalian cells; SV40 permissive cells
Parental clone: pCAGGS-E-hA20-R439A
Further information: The plasmid was constructed by introducing an R742A mutation into pCAGGS-E-hA20-R439A via site-directed mutagenesis. A silent NheI restriction site was introduced via PCR, amplifying the parental vector from the NheI-location outwards, cutting the resulting fragment with AdeI/NheI and NheI/XhoI and ligating both parts into the AdeI/XhoI opened pCAGGS-E-hA20-R439A vector.
A candidate site for the putative p75 cleavage site (described in Malinverni et al. (2010) and Wiesmann et al. (2012)) was mutated in human A20-R439A via site-directed mutagenesis. The R742A substitution was made along with a silent NheI site for fast genotyping and cloning.
Expression was confirmed by the depositor in HEK293T transfections.
EMBL Accession number: -
Latest sequence update: 11/06/2015
Sequence detail:
Primers used to introduce the R742A mutation and the silent NheI site in human A20:

hA20-AdeI-F: 5' ACAGAGCTGGAAACGACGC

pCAGGS-R:    5' CCATAAGAGAAGAGGGACAGC

NheI-hA20-LACR/A-R: 5' CCTCGCTAGCGCAGGCCAGGATGTTC
                           NheI

NheI-hA20-LACR/A-F: 5' CCTGCGCTAGCGAGGAGCTCTGCATG
                            NheI
Authenticity test: The plasmid still needs to be subjected to the authenticity test.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Dr J. Staal(1) (2) and Prof. Dr R. Beyaert(1) (2).
(1) Inflammation Research Center, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: -
Related plasmid reference: Malinverni et al., Biochem. Biophys. Res. Commun. 400 (2010), 543-547 [PMID: 20804738] [DOI: 10.1016/j.bbrc.2010.08.091]
Wiesmann et al., J. Mol. Biol. 419 (2012), 4-21 [PMID: 22366302] [DOI: 10.1016/j.jmb.2012.02.018]
Restricted distribution: - VIB/BCCM MTA
- Restricted to academic users
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061
Host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Related host reference: Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Other culture collection numbers: -

Refer in your Materials and Methods:

pCAGGS-E-hA20-R439A-R742A (LMBP 7786) is available at BCCM/GeneCorner. This plasmid was deposited by Dr J. Staal and Prof. Dr R. Beyaert .

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search