Last data update: 06 March 2021 04:22 CET
Plasmid name: pCAGGS-E-hA20L435G (LMBP 5692)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner non-core plasmid |
Depositor's sequence: | p5692.gb |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Human TNF alpha induced protein 3 cDNA (TNFAIP3, A20, OTUD7C, GeneID 7128); mutated sequence E-tag; N-terminal |
Promoter: | Chicken β-actin/rabbit β-globin hybrid promoter (AG) Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only Escherichia coli lac operon promoter |
Ribosome binding site: |
- |
Terminator: | Rabbit β-globin polyadenylation signal (β-globin polyA) Simian virus 40 polyadenylation signal (SV40 polyA) |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin Simian virus 40 bidirectional origin (SV40) |
Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
Parental clone: | pCAGGSEhA20 |
Further information: | The plasmid was created by introducing the L435G mutation into the human A20 cDNA of pCAGGSEhA20 via fusion PCR. pCAGGS-E-hA20L435G is useful for highly efficient expression of the E-tagged mutated human A20 under the control of the AG promoter and the hCMV-IE enhancer in various mammalian cells. L at position 435 (putative needed P5 position for MALT1 cleavage) has been mutated to a G. When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. The nucleotide sequence of the wild type human A20 cDNA corresponds with the EMBL Nucleotide Sequence Database accession number M59465.1. |
EMBL Accession number: | M59465.1, view at EMBL, GenBank, DDBJ |
Latest sequence update: | 02/04/2012 |
Sequence detail: | Fusion PCR primers used to introduce the L435 mutation in the human A20 cDNA: Forward primer 1: 5' CCTGGCATGGCGGGGGGGGCCTCTCGGGGA Reverse primer 1: 5' TCCCCGAGAGGCCCCCCCCGCCATGCCAGG Forward primer 2: 5' CCGAGCTGTTCCACTTGTTAACAGAGAGAC HpaI Reverse primer 2: 5' ATGCTGACACTCCATGCAGAGCTCC SacI |
Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by J. Staal(1) (2) and Prof. Dr R. Beyaert(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | - |
Related plasmid reference: | Hulpiau et al., Cell. Mol. Life Sci. 73 (2016), 1103-1116 [PMID: 26377317] [DOI: 10.1007/s00018-015-2041-9] Staal et al., J. Mol. Biol. 419 (2012), 1–3 [PMID: 22426126] [DOI: 10.1016/j.jmb.2012.03.006] |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 MC1061 |
Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Cultivation remark: | - |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pCAGGS-E-hA20L435G (LMBP 5692) is available at BCCM/GeneCorner. This plasmid was deposited by J. Staal and Prof. Dr R. Beyaert . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.