GREAT AT SMALL THINGS

0

GeneCorner plasmid details

Last data update: 22 October 2020 04:25 CEST

Plasmid name: pCAGGS-E-hABIN-2 (LMBP 4368)

Add to cart

New search

Price category: Cat. 1 (cf. price list)
Status: GeneCorner core plasmid
GeneCorner sequence: p4368.gb (View with Genome Compiler)
p4368.txt
p4368.pdf
Sequence
analysis results
Genecorner:

-

Cloned DNA: Human A20-binding inhibitor of NF-κB activation 2 cDNA (ABIN-2, TNIP2)
E-tag; N-terminal
Promoter: Chicken β-actin/rabbit β-globin hybrid promoter (AG)
Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only
Escherichia coli lac operon promoter
Ribosome
binding site:
-
Terminator: Rabbit β-globin polyadenylation signal (β-globin polyA)
Simian virus 40 polyadenylation signal (SV40 polyA)
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Simian virus 40 bidirectional origin (SV40)
Host range: Escherichia coli
Mammalian cells; SV40 permissive cells
Parental clone: pCAGGS-E-hABIN-2i
Further information: The plasmid was constructed by inserting a BglII/AflII cut PCR amplicon, containing part of the hABIN-2 cDNA, in the BglII/AflII opened pCAGGS-E-hABIN-2i plasmid. Consequently, pCAGGS-E-hABIN-2 contains the full-length hABIN-2 cDNA, without internal intron, fused to an N-terminal E-tag.
pCAGGS-E-hABIN-2 is useful for highly efficient expression of hABIN-2 under the control of the AG promoter and the human CMV-IE enhancer in various mammalian cells.
When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide.
The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727200.1.
The nucleotide sequence of the hABIN-2 cDNA corresponds with the EMBL Nucleotide Sequence Database accession number AJ304866.1.
EMBL Accession number: AJ304866.1, view at EMBL, GenBank, DDBJ
LT727200.1, view at EMBL, GenBank, DDBJ
Latest sequence update: 28/06/2001
Sequence detail:
Primers used on EST (Genbank Accession number AA081482) to generate the insert:

Forward primer 
5' GCTGAGCCAGCCCCAACA 3'

Reverse primer
5' GAGGATCCGCAGACATGTGGCTCGCAATG 3'
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: BglII, BspTI(AflII)/BglII, BstXI, DraI and NcoI.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Prof. Dr R. Beyaert(1) (2).
(1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: Van Huffel et al., J. Biol. Chem. 276 (2001), 30216-30223 [PMID: 11390377]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 DH5α
Host reference: Focus 8 (1986), 9
Related host reference: Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051]
Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187]
Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791]
Rodriguez-Quinones et al., Focus 15 (1993), 110-112
Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Refer in your Materials and Methods:

pCAGGS-E-hABIN-2 (LMBP 4368) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr R. Beyaert and was published in Van Huffel et al., 2001.

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search