Last data update: 24 January 2024 16:39 CET
Plasmid name: pCAGGS-E-hABIN-2i (LMBP 4369)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | p4369.gb |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Human A20-binding inhibitor of NF-κB activation 2 cDNA (ABIN-2, TNIP2); with internal intron insertion E-tag; N-terminal |
| Promoter: | Chicken β-actin/rabbit β-globin hybrid promoter (AG) Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only Escherichia coli lac operon promoter |
| Ribosome binding site: |
- |
| Terminator: | Rabbit β-globin polyadenylation signal (β-globin polyA) Simian virus 40 polyadenylation signal (SV40 polyA) |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin Simian virus 40 bidirectional origin (SV40) |
| Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
| Parental clone: | pCAGGS-E-mABIN-2f2 |
| Further information: | The plasmid was constructed by inserting a KpnI/BamHI fragment containing the human A20-binding inhibitor of NF-κB activation 2 cDNA (hABIN-2) with internal intron insertion and a N-terminal E-tag, into the KpnI-BglII opened pCAGGS-E-mABIN-2f2 vector. Because of the intron present in the hABIN-2 cDNA, two protein forms are generated. The AG promoter sequence consists of the chicken β-actin promoter, the first exon and part of the first intron (that seems to have a strong enhancer-like activity) linked to a rabbit β-globin fragment, consisting of a 3' part of the second intron (inclusive a branch point which is required for normal splicing reactions) and a 5' part of the third exon. When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. The nucleotide sequence of the hABIN-2 coding sequence corresponds with the EMBL Nucleotide Sequence Database accession number AJ304866.1. Other name of the plasmid is pCAGGS-E-hABIN-2ins. |
| EMBL Accession number: | AJ304866.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 28/06/2001 |
| Sequence detail: | Primers used on EST (Accession number AW170250) to generate the insert:
Forward primer : 5' AAGGATCCGGTACC.ATG.TCC.CGG.GAC.CCG.GGG.T 3'
KpnI ***
Reverse primer : 5' GAGGATCCGCAGACATGTGGCTCGCAATG 3'
***: start codon. |
| Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Prof. Dr R. Beyaert(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | - |
| Related plasmid reference: | Van Huffel et al., J. Biol. Chem. 276 (2001), 30216-30223 [PMID: 11390377] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 DH5α |
| Host reference: | Focus 8 (1986), 9 |
| Related host reference: | Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pCAGGS-E-hABIN-2i (LMBP 4369) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr R. Beyaert . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.