GREAT AT SMALL THINGS

0

GeneCorner plasmid details

Last data update: 29 November 2020 04:28 CET

Plasmid name: pCAGGS-E-hABIN-2i (LMBP 4369)

Add to cart

New search

Price category: Cat. 1 (cf. price list)
Status: GeneCorner non-core plasmid
Depositor's sequence: p4369.gb
Sequence
analysis results
Genecorner:

-

Cloned DNA: Human A20-binding inhibitor of NF-κB activation 2 cDNA (ABIN-2, TNIP2); with internal intron insertion
E-tag; N-terminal
Promoter: Chicken β-actin/rabbit β-globin hybrid promoter (AG)
Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only
Escherichia coli lac operon promoter
Ribosome
binding site:
-
Terminator: Rabbit β-globin polyadenylation signal (β-globin polyA)
Simian virus 40 polyadenylation signal (SV40 polyA)
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Simian virus 40 bidirectional origin (SV40)
Host range: Escherichia coli
Mammalian cells; SV40 permissive cells
Parental clone: pCAGGS-E-mABIN-2f2
Further information: The plasmid was constructed by inserting a KpnI/BamHI fragment containing the human A20-binding inhibitor of NF-κB activation 2 cDNA (hABIN-2) with internal intron insertion and a N-terminal E-tag, into the KpnI-BglII opened pCAGGS-E-mABIN-2f2 vector.
Because of the intron present in the hABIN-2 cDNA, two protein forms are generated.
The AG promoter sequence consists of the chicken β-actin promoter, the first exon and part of the first intron (that seems to have a strong enhancer-like activity) linked to a rabbit β-globin fragment, consisting of a 3' part of the second intron (inclusive a branch point which is required for normal splicing reactions) and a 5' part of the third exon.
When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide.
The nucleotide sequence of the hABIN-2 coding sequence corresponds with the EMBL Nucleotide Sequence Database accession number AJ304866.1.
Other name of the plasmid is pCAGGS-E-hABIN-2ins.
EMBL Accession number: AJ304866.1, view at EMBL, GenBank, DDBJ
Latest sequence update: 28/06/2001
Sequence detail:
Primers used on EST (Accession number AW170250) to generate the insert:

Forward primer : 5' AAGGATCCGGTACC.ATG.TCC.CGG.GAC.CCG.GGG.T 3'
                            KpnI   ***

Reverse primer : 5' GAGGATCCGCAGACATGTGGCTCGCAATG 3'

***: start codon.
Authenticity test: The plasmid still needs to be subjected to the authenticity test.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Prof. Dr R. Beyaert(1) (2).
(1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: -
Related plasmid reference: Van Huffel et al., J. Biol. Chem. 276 (2001), 30216-30223 [PMID: 11390377]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 DH5α
Host reference: Focus 8 (1986), 9
Related host reference: Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051]
Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187]
Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791]
Rodriguez-Quinones et al., Focus 15 (1993), 110-112
Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Refer in your Materials and Methods:

pCAGGS-E-hABIN-2i (LMBP 4369) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr R. Beyaert .

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search