Last data update: 12 April 2021 09:56 CEST
Plasmid name: pCAGGS-E-hCASP-1 (LMBP 4715)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner core plasmid |
GeneCorner sequence: |
p4715.gb
(View with Genome Compiler) p4715.pdf |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Human apoptosis-related cysteine peptidase cDNA (caspase-1, CASP1, CASP-1, ICE, P45, IL1BC) E-tag; N-terminal |
Promoter: | Chicken β-actin/rabbit β-globin hybrid promoter (AG) Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only Escherichia coli lac operon promoter |
Ribosome binding site: |
- |
Terminator: | Rabbit β-globin polyadenylation signal (β-globin polyA) Simian virus 40 polyadenylation signal (SV40 polyA) |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin Simian virus 40 bidirectional origin (SV40) |
Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
Parental clone: | pCAGGS-Etag-INCA |
Further information: | The plasmid was constructed by inserting a NotI-BglII PCR fragment, containing the hCASP-1 coding sequence, between the NotI and BglII site of pCAGGS-Etag-INCA. pCAGGS-E-hCASP-1 is useful for highly efficient expression of hCASP-1, fused in phase to the N-terminal E-tag, under the control of the AG promoter and the hCMV-IE enhancer in various mammalian cells. The AG promoter sequence consists of the chicken β-actin promoter, the first exon and part of the first intron (that seems to have a strong enhancer-like activity) linked to a rabbit β-globin fragment, consisting of a 3' part of the second intron (inclusive a branch point which is required for normal splicing reactions) and a 5' part of the third exon. When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. The nucleotide sequence of the hCASP-1 cDNA corresponds with the EMBL Nucleotide Sequence Database accession number M87507.1. Other name of the plasmid is pCAGGS-E-hCASPASE-1. |
EMBL Accession number: | M87507.1, view at EMBL, GenBank, DDBJ |
Latest sequence update: | 19/11/2003 |
Sequence detail: | Nucleotide sequence at the start of hCASP-1: ---------------------- E-tag ---------------------> 5' ... TTCCACC.ATG.GGT.GCG.CCG.GTG.CCG.TAT.CCG.GAC.CCG.CTG.GAA.CCG.CGT.GCG.GCC Met Gly Ala Pro Val Pro Tyr Pro Asp Pro Leu Glu Pro Arg Ala Ala *** NotI NcoI StyI ----------------------- hCASP-1 -----------------------> GCG.CCG.ATG.GCC.GAC.AAG.GTC.CTG.AAG.GAG.AAG.AGA.AAG.CTG.TTT.ATC ... 3' Ala Pro Met Ala Asp Lys Val Leu Lys Glu Lys Arg Lys Leu Phe Ile *** Nucleotide sequence at the end of hCASP-1: --------------- hCASP-1 ---------------> 5' ... AGA.TGT.TTC.TAC.CTC.TTC.CCA.GGA.CAT.TAA.AATAAGGAAACTGTATGAATGTCTGTGGGC Arg Cys Phe Tyr Leu Phe Pro Gly His +++ -- ß-globin polyA -> AGGAAGTGAAGAGATCGTTCTGTAAAGATCTTTTTCCCTCTGCC ... 3' BglII ***: start codon. +++: termination codon. Punctuation indicates reading frame. |
Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: BglII/NotI, EcoRI, HindIII/SpeI and MspA1I. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by M. Lamkanfi(1) (2), Dr M. Kalai(1) (2) and Prof. Dr P. Vandenabeele(1) (2). It was constructed by M. Lamkanfi(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | - |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 MC1061(λ) |
Host reference: | Mertens et al., Gene 164 (1995), 9-15 [PMID: 7590329] |
Related host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 28°C |
Biosafety level: | L1 |
Cultivation remark: | - |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pCAGGS-E-hCASP-1 (LMBP 4715) is available at BCCM/GeneCorner. This plasmid was deposited by M. Lamkanfi , Dr M. Kalai and Prof. Dr P. Vandenabeele . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.