Last data update: 24 January 2024 16:39 CET
Plasmid name: pCAGGS-E-hPELI2 (LMBP 5197)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner core plasmid |
GeneCorner sequence: |
p5197.gb
(View with Genome Compiler) p5197.txt p5197.pdf |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Human pellino 2 cDNA (PELI2) E-tag; N-terminal |
Promoter: | Chicken β-actin/rabbit β-globin hybrid promoter (AG) Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only Escherichia coli lac operon promoter |
Ribosome binding site: |
- |
Terminator: | Rabbit β-globin polyadenylation signal (β-globin polyA) Simian virus 40 polyadenylation signal (SV40 polyA) |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin Simian virus 40 bidirectional origin (SV40) |
Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
Parental clone: | pCAGGS |
Further information: | The plasmid was constructed as follows: 1) the PELI2 cDNA was picked up from human cDNA, first with primers specific for the untranslated regions (one upstream of and one downstream from the coding sequence) and then with coding sequence specific primers; 2) the NotI/XhoI digested PCR amplicon was fused in frame to the E-tag of a NotI/XhoI opened pCAGGS-based expression plasmid. pCAGGS-E-hPELI2 is useful for highly efficient expression of E-tagged human PELI2 under the control of the AG promoter and the human CMV-IE enhancer in various mammalian cells. When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. The nucleotide sequence of the human PELI2 cDNA corresponds with the EMBL Nucleotide Sequence Database accession number AF302502.1. The hPELI2 insert was sequenced by the depositor. Other name of the plasmid is pCAGGS-E-hPeli-2WT. |
EMBL Accession number: | AF302502.1, view at EMBL, GenBank, DDBJ |
Latest sequence update: | 29/10/2009 |
Sequence detail: | Primers specific for the untranslated regions: forward: 5' GGGGCTCCATGTTTTCCCCTG 3' reverse: 5' TGTCAAGGGCGTCAGTCAATTGG 3' Coding sequence specific primers: forward: 5' ATAAGAATGCGGCCGCA.ATG.TTT.TCC.CCT.GGC.CAG.GA 3' NotI *** reverse: 5' CCGCTCGAG.TCA.GTC.AAT.TGG.ACC.TTG.GAA.A 3' XhoI +++ ***: start codon. +++: termination codon. |
Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: Alw44I/SacII, HincII, NcoI/XmnI, NotI/XhoI and SspI. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Prof. Dr R. Beyaert(1) (2). It was constructed by Dr R. Schauvliege(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | Schauvliege et al., FEBS Lett. 580 (2006), 4697-4702 [PMID: 16884718] |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 MC1061 |
Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Cultivation remark: | - |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pCAGGS-E-hPELI2 (LMBP 5197) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr R. Beyaert and was published in Schauvliege et al., 2006. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.