GREAT AT SMALL THINGS

0

GeneCorner plasmid details

Last data update: 24 January 2024 16:39 CET

Plasmid name: pCAGGS-E-hPELI3-DR (LMBP 5199)

Add to cart

New search Print data sheet
Price category: Cat. 1 (cf. price list)
Status: GeneCorner non-core plasmid
Depositor's sequence: p5199.gb
Sequence
analysis results
Genecorner:

-

Cloned DNA: Human pellino 3 α cDNA (PELI3); N-terminal part encoding amino acids 1-383, RING-domain deleted
E-tag; N-terminal
Promoter: Chicken β-actin/rabbit β-globin hybrid promoter (AG)
Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only
Escherichia coli lac operon promoter
Ribosome
binding site:
-
Terminator: Rabbit β-globin polyadenylation signal (β-globin polyA)
Simian virus 40 polyadenylation signal (SV40 polyA)
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Simian virus 40 bidirectional origin (SV40)
Host range: Escherichia coli
Mammalian cells; SV40 permissive cells
Parental clone: pCAGGS-E-hPELI3
Further information: The plasmid was constructed as follows: 1) a C-terminal deletion mutant of the human PELI3 cDNA, encoding amino acids 1 up to 383 and lacking most of the RING motif, was generated by PCR; 2) 2) the NotI/XhoI digested PCR amplicon was fused in frame to the E-tag of a NotI/XhoI opened pCAGGS-based expression plasmid.
The nucleotide sequence of the hPELI3 cDNA corresponds with the EMBL Nucleotide Sequence Database accession number AF487456.1. The hPELI3 insert was sequenced by the depositor.
Other name of the plasmid is pCAGGS-E-hPeli-3DR.
EMBL Accession number: AF487456.1, view at EMBL, GenBank, DDBJ
Latest sequence update: 14/09/2007
Sequence detail:
The primers used in PCR to amplify hPELI3-DR cDNA were:

forward: 5' ATAAGAATGCGGCCGCAATGGTGCTGGAAGGAAACCC 3'
                    NotI

reverse: 5' CCGCTCGAGTTATTCGCGCTCCTGGGG 3'
               XhoI
Authenticity test: The plasmid still needs to be subjected to the authenticity test.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Prof. Dr R. Beyaert(1) (2). It was constructed by Dr R. Schauvliege(1) (2).
(1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: Schauvliege et al., FEBS Lett. 580 (2006), 4697-4702 [PMID: 16884718]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061
Host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Related host reference: Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Other culture collection numbers: -

Refer in your Materials and Methods:

pCAGGS-E-hPELI3-DR (LMBP 5199) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr R. Beyaert and was published in Schauvliege et al., 2006.

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search