Last data update: 26 March 2021 09:08 CET
Plasmid name: pCAGGS-E-hPELI3-DR (LMBP 5199)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner non-core plasmid |
Depositor's sequence: | p5199.gb |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Human pellino 3 α cDNA (PELI3); N-terminal part encoding amino acids 1-383, RING-domain deleted E-tag; N-terminal |
Promoter: | Chicken β-actin/rabbit β-globin hybrid promoter (AG) Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only Escherichia coli lac operon promoter |
Ribosome binding site: |
- |
Terminator: | Rabbit β-globin polyadenylation signal (β-globin polyA) Simian virus 40 polyadenylation signal (SV40 polyA) |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin Simian virus 40 bidirectional origin (SV40) |
Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
Parental clone: | pCAGGS-E-hPELI3 |
Further information: | The plasmid was constructed as follows: 1) a C-terminal deletion mutant of the human PELI3 cDNA, encoding amino acids 1 up to 383 and lacking most of the RING motif, was generated by PCR; 2) 2) the NotI/XhoI digested PCR amplicon was fused in frame to the E-tag of a NotI/XhoI opened pCAGGS-based expression plasmid. The nucleotide sequence of the hPELI3 cDNA corresponds with the EMBL Nucleotide Sequence Database accession number AF487456.1. The hPELI3 insert was sequenced by the depositor. Other name of the plasmid is pCAGGS-E-hPeli-3DR. |
EMBL Accession number: | AF487456.1, view at EMBL, GenBank, DDBJ |
Latest sequence update: | 14/09/2007 |
Sequence detail: | The primers used in PCR to amplify hPELI3-DR cDNA were: forward: 5' ATAAGAATGCGGCCGCAATGGTGCTGGAAGGAAACCC 3' NotI reverse: 5' CCGCTCGAGTTATTCGCGCTCCTGGGG 3' XhoI |
Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Prof. Dr R. Beyaert(1) (2). It was constructed by Dr R. Schauvliege(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | Schauvliege et al., FEBS Lett. 580 (2006), 4697-4702 [PMID: 16884718] |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 MC1061 |
Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pCAGGS-E-hPELI3-DR (LMBP 5199) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr R. Beyaert and was published in Schauvliege et al., 2006. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.