Last data update: 24 January 2024 16:39 CET
Plasmid name: pCAGGS-E-hPTB (LMBP 5260)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner core plasmid |
GeneCorner sequence: |
p5260.gb
(View with Genome Compiler) p5260.txt p5260.pdf |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Human polypyrimidine tract binding protein 1 cDNA (PTBP1, HNRNP-I, HNRPI, pPTB, PTB-1, PTB2, PTB3, PTB4, GeneID 5725) E-tag; N-terminal |
Promoter: | Chicken β-actin/rabbit β-globin hybrid promoter (AG) Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only Escherichia coli lac operon promoter |
Ribosome binding site: |
- |
Terminator: | Rabbit β-globin polyadenylation signal (β-globin polyA) Simian virus 40 polyadenylation signal (SV40 polyA) |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin Simian virus 40 bidirectional origin (SV40) |
Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
Parental clone: | pCAGGS |
Further information: | The plasmid was constructed as follows: 1) the human PTBP1 cDNA was amplified by PCR; 2) the NotI/XhoI digested PCR amplicon was fused to the E-tag of a NotI/XhoI opened pCAGGS-based expression plasmid. pCAGGS-E-hPTB is useful for highly efficient expression of human PTBP1 under the control of the AG promoter and the human CMV-IE enhancer in various mammalian cells. When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT726990.1. The nucleotide sequence of the human PTBP1 cDNA corresponds with the Genbank Nucleotide Sequence Database accession number NM_002819.4. Name mentioned in Schepens et al. (2005) is pcPTB. Other name of the plasmid is pCAGGS E PTB. |
EMBL Accession number: | NM_002819.4, view at GenBank LT726990.1, view at EMBL, GenBank, DDBJ |
Latest sequence update: | 02/02/2007 |
Sequence detail: | Primers used to amplify the hPTB coding sequence: forward: 5' ATAAGAAAGCGGCCGCTATGGACGGCATTGTCCCAGATATAG 3' NotI reverse: 5' AACCGCTCGAGCTAGATGGTGGACTTGGAGAAGGAGACCCG 3' XhoI |
Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: NcoI, NotI and NotI/XhoI. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Y. Bruynooghe(1) (2) and Prof. Dr R. Beyaert(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | Cornelis et al., Nucleic Acids Res. 33 (2005), 3095-3108 [PMID: 15928332] |
Related plasmid reference: | Schepens et al., Nucleic Acids Res. 33 (2005), 6884-6894 [PMID: 16396835] |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 MC1061 |
Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Cultivation remark: | - |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pCAGGS-E-hPTB (LMBP 5260) is available at BCCM/GeneCorner. This plasmid was deposited by Y. Bruynooghe and Prof. Dr R. Beyaert and was published in Cornelis et al., 2005. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.