Last data update: 24 January 2024 16:39 CET
Plasmid name: pCAGGS-E-mABIN-1 (LMBP 8221)
| New search | Print data sheet |
| Price category: | Cat. 1 (cf. price list) |
| Status: | GeneCorner non-core plasmid |
| Depositor's sequence: | p8221.gb |
| Sequence analysis results Genecorner: |
- |
| Cloned DNA: |
Mouse A20-binding inhibitor of NF-κB activation 1 cDNA (ABIN-1, TNIP1) E-tag; N-terminal |
| Promoter: | Chicken β-actin/rabbit β-globin hybrid promoter (AG) Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only Escherichia coli lac operon promoter |
| Ribosome binding site: |
- |
| Terminator: | Rabbit β-globin polyadenylation signal (β-globin polyA) Simian virus 40 polyadenylation signal (SV40 polyA) |
| Selection marker: | Ampicillin (amp) |
| Replicon: | Escherichia coli plasmid pMB1 origin Simian virus 40 bidirectional origin (SV40) |
| Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
| Parental clone: | pCAGGS; pCAGGSEhA20 |
| Further information: | The plasmid was constructed as follows: full lenght mABIN-1 was generated by PCR, the PCR fragment was NotI-SmaI digested and cloned in a 3-point ligation with a NotI-PvuI fragment of pCAGGSEhA20 and a MscI-PvuI fragment of pCAGGS. pCAGGS-E-mABIN-1 is useful for highly efficient expression of mABIN-1, under the control of the AG promoter and the hCMV-IE enhancer in various mammalian cells. When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. The nucleotide sequence of the mABIN-1 cDNA corresponds with the EMBL Nucleotide Sequence Database accession number AJ242778.1. |
| EMBL Accession number: | AJ242778.1, view at EMBL, GenBank, DDBJ |
| Latest sequence update: | 18/01/2007 |
| Sequence detail: | Primers used in PCR to amplify mABIN-1 cDNA:
forward: 5' ATAAGAATGCGGCCGCC.ATG.GAA.GGG.AGA.GGA.CC 3'
NotI ***
reverse: 5' TCCCCCGGGTCTTGTCAACAGTTCGAGG 3'
SmaI
***: start codon.
Punctuation indicates reading frame. |
| Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: ApaI, HincII/NotI and PvuI. The ApaI site at position 5700 could not be experimentally confirmed. |
| Class: | Recombinant plasmid |
| Type: | Plasmid |
| History of deposit: | This plasmid was deposited by Dr K. Heyninck(1) (2) and Prof. Dr R. Beyaert(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
| Plasmid reference: | Heyninck et al., J. Cell Biol. 145 (1999), 1471-1482 [PMID: 10385526] |
| Restricted distribution: | - BCCM MTA |
| Distributed as: | H/P active culture or plasmid DNA |
| Host for distribution: | Escherichia coli K12 DH5α |
| Host reference: | Focus 8 (1986), 9 |
| Related host reference: | Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
| Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
| Cultivation temperature: | 37°C |
| Biosafety level: | L1 |
| Cultivation remark: | - |
| Other culture collection numbers: | LMBP 05356 |
Refer in your Materials and Methods: |
pCAGGS-E-mABIN-1 (LMBP 8221) is available at BCCM/GeneCorner. This plasmid was deposited by Dr K. Heyninck and Prof. Dr R. Beyaert and was published in Heyninck et al., 1999. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.