GREAT AT SMALL THINGS

0

GeneCorner plasmid details

Last data update: 24 January 2024 16:39 CET

Plasmid name: pCAGGS-E-mABIN-1(388-560) (LMBP 5365)

Add to cart

New search Print data sheet
Price category: Cat. 1 (cf. price list)
Status: GeneCorner non-core plasmid
Depositor's sequence: not available
Sequence
analysis results
Genecorner:

-

Cloned DNA: Mouse A20-binding inhibitor of NF-κB activation 1 cDNA (ABIN-1, TNIP1); C-terminal fragment encoding amino acids (388-560)
E-tag; N-terminal
Promoter: Chicken β-actin/rabbit β-globin hybrid promoter (AG)
Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only
Escherichia coli lac operon promoter
Ribosome
binding site:
-
Terminator: Rabbit β-globin polyadenylation signal (β-globin polyA)
Simian virus 40 polyadenylation signal (SV40 polyA)
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Simian virus 40 bidirectional origin (SV40)
Host range: Escherichia coli
Mammalian cells; SV40 permissive cells
Parental clone: pCAGGS; pCAGGSEhA20
Further information: The plasmid was constructed as follows: a splice variant (388-560) of mouse ABIN-1 was generated by PCR, the PCR fragment was NotI-SmaI digested and cloned in a 3-point ligation with a NotI-PvuI fragment of pCAGGS-E-A20 and a MscI-PvuI fragment of pCAGGS.
pCAGGS-E-mABIN-1(388-560) is useful for highly efficient expression of a C-terminal fragment (aa 388-560) of mouse A20-binding inhibitor of NF-kappa B activation (ABIN1), under the control of the chicken β-actin/rabbit β-globin hybrid promoter (AG) and the human CMV-IE enhancer in various mammalian cells.
When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide.
The nucleotide sequence of the mABIN-1 cDNA corresponds with the EMBL Nucleotide Sequence Database accession number AJ242778.1.
EMBL Accession number: AJ242778.1, view at EMBL, GenBank, DDBJ
Latest sequence update: 16/05/2007
Sequence detail:
The primers used in PCR to amplify mABIN-1(10) cDNA were:

forward: 5' ATAAGAATGCGGCCGCAGAGATGGAAGAGACCG 3'
                    NotI

reverse: 5' TCCCCCGGGTCAGGCGCCGCAGACGTGCTCAGGG 3'
               SmaI
Authenticity test: The plasmid still needs to be subjected to the authenticity test.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Prof. Dr R. Beyaert(1) (2).
(1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: -
Related plasmid reference: Heyninck et al., FEBS Lett. 442 (1999), 147-150 [PMID: 9928991]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061
Host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Related host reference: Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Refer in your Materials and Methods:

pCAGGS-E-mABIN-1(388-560) (LMBP 5365) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr R. Beyaert .

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search