GREAT AT SMALL THINGS

0

GeneCorner plasmid details

Last data update: 24 January 2024 16:39 CET

Plasmid name: pCAGGS-E-mABIN-1(444-647) (LMBP 5369)

Add to cart

New search Print data sheet
Price category: Cat. 1 (cf. price list)
Status: GeneCorner core plasmid
GeneCorner sequence: p5369.gb (View with Genome Compiler)
p5369.txt
p5369.pdf
Sequence
analysis results
Genecorner:

-

Cloned DNA: Mouse A20-binding inhibitor of NF-κB activation 1 cDNA (ABIN-1, TNIP1); C-terminal fragment encoding amino acids 444-647
E-tag; N-terminal
Promoter: Chicken β-actin/rabbit β-globin hybrid promoter (AG)
Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only
Escherichia coli lac operon promoter
Ribosome
binding site:
-
Terminator: Rabbit β-globin polyadenylation signal (β-globin polyA)
Simian virus 40 polyadenylation signal (SV40 polyA)
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Simian virus 40 bidirectional origin (SV40)
Host range: Escherichia coli
Mammalian cells; SV40 permissive cells
Parental clone: pCAGGS; pCAGGSEhA20
Further information: The plasmid was constructed as follows: 1) a C-terminal fragment of the mABIN-1 cDNA, encoding amino acids 444 up to 647, was generated by PCR; 2) the PCR amplicon was NotI-SmaI digested and cloned in a 3-point ligation with a MscI-PvuI fragment of pCAGGS and a PvuI-NotI fragment of pCAGGSEhA20.
pCAGGS-E-mABIN-1(444-647) is useful for highly efficient expression of mABIN-1(444-647), under the control of the chicken β-actin/rabbit β-globin hybrid promoter (AG) and the human CMV-IE enhancer in various mammalian cells.
The AG promoter sequence consists of the chicken β-actin promoter, the first exon and part of the first intron (that seems to have a strong enhancer-like activity) linked to a rabbit β-globin fragment, consisting of a 3' part of the second intron (inclusive a branch point which is required for normal splicing reactions) and a 5' part of the third exon.
When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide.
The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727022.1.
The nucleotide sequence of the mABIN-1 cDNA corresponds with the EMBL Nucleotide Sequence Database accession number AJ242778.1.
Other name of the plasmid is pCAGGS-E-mABIN-1(14).
EMBL Accession number: AJ242778.1, view at EMBL, GenBank, DDBJ
LT727022.1, view at EMBL, GenBank, DDBJ
Latest sequence update: 03/04/2007
Sequence detail:
The primers used in PCR to amplify mABIN-1(444-647) cDNA were:

forward: 5' ATAAGAATGCGGCCGCAGCCTCTCCATCATCTCCG 3'
                    NotI

reverse: 5' TCCCCCGGGTCTTGTCAACAGTTCGAGG 3'
               SmaI
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: BsrDI, CaiI, NcoI and NotI.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Dr K. Heyninck(1) (2) and Prof. Dr R. Beyaert(1) (2).
(1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: Heyninck et al., FEBS Lett. 536 (2003), 135-140 [PMID: 12586352]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061
Host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Related host reference: Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Refer in your Materials and Methods:

pCAGGS-E-mABIN-1(444-647) (LMBP 5369) is available at BCCM/GeneCorner. This plasmid was deposited by Dr K. Heyninck and Prof. Dr R. Beyaert and was published in Heyninck et al., 2003.

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search