Last data update: 24 January 2024 16:39 CET
Plasmid name: pCAGGS-E-mABIN-1(469-560) (LMBP 5373)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner core plasmid |
GeneCorner sequence: |
p5373.gb
(View with Genome Compiler) p5373.txt p5373.pdf |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Mouse A20-binding inhibitor of NF-κB activation 1 cDNA (ABIN-1, TNIP1); C-terminal fragment encoding amino acids 469-560 E-tag; N-terminal |
Promoter: | Chicken β-actin/rabbit β-globin hybrid promoter (AG) Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only Escherichia coli lac operon promoter |
Ribosome binding site: |
- |
Terminator: | Rabbit β-globin polyadenylation signal (β-globin polyA) Simian virus 40 polyadenylation signal (SV40 polyA) |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin Simian virus 40 bidirectional origin (SV40) |
Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
Parental clone: | pCAGGS; pCAGGSEhA20 |
Further information: | The plasmid was constructed as follows: 1) a C-terminal fragment of the mouse A20-binding inhibitor of NF-κB activation 1 cDNA (mABIN-1), encoding amino acids 469 up to 560, was generated by PCR; 2) the PCR amplicon was NotI-SmaI digested and cloned in a 3-point ligation with a MscI-PvuI fragment of pCAGGS and a PvuI-NotI fragment of pCAGGSEhA20. pCAGGS-E-mABIN-1(469-560) is useful for highly efficient expression of mABIN-1(469-560), under the control of the chicken β-actin/rabbit β-globin hybrid promoter (AG) and the human CMV-IE enhancer in various mammalian cells. The AG promoter sequence consists of the chicken β-actin promoter, the first exon and part of the first intron (that seems to have a strong enhancer-like activity) linked to a rabbit β-globin fragment, consisting of a 3' part of the second intron (inclusive a branch point which is required for normal splicing reactions) and a 5' part of the third exon. When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727027.1. The nucleotide sequence of the mABIN-1 cDNA corresponds with the EMBL Nucleotide Sequence Database accession number AJ242778.1. Other name of the plasmid is pCAGGS-E-mABIN-1(18). |
EMBL Accession number: | AJ242778.1, view at EMBL, GenBank, DDBJ LT727027.1, view at EMBL, GenBank, DDBJ |
Latest sequence update: | 16/05/2007 |
Sequence detail: | The primers used in PCR to amplify mABIN-1(469-560) cDNA were: forward: 5' ATAAGAATGCGGCCGCAGTGACACAGAATGAGTTGC 3' NotI reverse: 5' TCCCCCGGGTCAGGCGCCGCAGACGTGCTCAGGG 3' SmaI |
Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: BglII, HindIII, NotI/PvuI and TaqI. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Dr K. Heyninck(1) (2) and Prof. Dr R. Beyaert(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | - |
Related plasmid reference: | Heyninck et al., FEBS Lett. 536 (2003), 135-140 [PMID: 12586352] |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 MC1061 |
Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Cultivation remark: | - |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pCAGGS-E-mABIN-1(469-560) (LMBP 5373) is available at BCCM/GeneCorner. This plasmid was deposited by Dr K. Heyninck and Prof. Dr R. Beyaert . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.