Last data update: 16 April 2021 10:31 CEST
Plasmid name: pCAGGS-E-mABIN-1(54-647) (LMBP 5357)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner non-core plasmid |
Depositor's sequence: | p5357.gb |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Mouse A20-binding inhibitor of NF-κB activation 1 cDNA (ABIN-1, TNIP1); splice variant encoding amino acids 54-647 E-tag; N-terminal |
Promoter: | Chicken β-actin/rabbit β-globin hybrid promoter (AG) Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only Escherichia coli lac operon promoter |
Ribosome binding site: |
- |
Terminator: | Rabbit β-globin polyadenylation signal (β-globin polyA) Simian virus 40 polyadenylation signal (SV40 polyA) |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin Simian virus 40 bidirectional origin (SV40) |
Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
Parental clone: | pCAGGS; pCAGGSEhA20 |
Further information: | The plasmid was constructed as follows: splice variant (2) (aa 54-647) of mouse ABIN-1 was generated by PCR, the PCR fragment was NotI-SmaI digested and cloned in a 3-point ligation with a NotI-PvuI fragment of pCAGGS-E-A20 and a MscI-PvuI fragment of pCAGGS. pCAGGS-E-mABIN-1(2) is useful for highly efficient expression of the splice variant (2) of mouse A20-binding inhibitor of NF-kappa B activation (ABIN1), under the control of the chicken β-actin/rabbit β-globin hybrid promoter (AG) and the human CMV-IE enhancer in various mammalian cells. When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. The nucleotide sequence of the mABIN-1 cDNA corresponds with the EMBL Nucleotide Sequence Database accession number AJ242778.1. Other name of the plasmid is pCAGGS-E-mABIN-1 (2). |
EMBL Accession number: | AJ242778.1, view at EMBL, GenBank, DDBJ |
Latest sequence update: | 13/02/2007 |
Sequence detail: | The primers used in PCR to amplify mABIN-1 splice variant (2) cDNA were: forward: 5' ATAAGAATGCGGCCGCGATGGAAGCGTCCAGACTCC 3' NotI reverse: 5' TCCCCCGGGTCTTGTCAACAGTTCGAGG 3' SmaI |
Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Dr K. Heyninck(1) (2) and Prof. Dr R. Beyaert(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | Heyninck et al., J. Cell Biol. 145 (1999), 1471-1482 [PMID: 10385526] |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 MC1061 |
Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pCAGGS-E-mABIN-1(54-647) (LMBP 5357) is available at BCCM/GeneCorner. This plasmid was deposited by Dr K. Heyninck and Prof. Dr R. Beyaert and was published in Heyninck et al., 1999. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.