GREAT AT SMALL THINGS

0

GeneCorner plasmid details

Last data update: 30 October 2020 04:11 CET

Plasmid name: pCAGGS-E-mABIN-2 (LMBP 4370)

Add to cart

New search

Price category: Cat. 1 (cf. price list)
Status: GeneCorner core plasmid
GeneCorner sequence: p4370.gb (View with Genome Compiler)
p4370.txt
p4370.pdf
Sequence
analysis results
Genecorner:

-

Cloned DNA: Mouse A20-binding inhibitor of NF-κB activation 2 cDNA (ABIN-2, TNIP2)
E-tag; N-terminal
Promoter: Chicken β-actin/rabbit β-globin hybrid promoter (AG)
Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only
Escherichia coli lac operon promoter
Ribosome
binding site:
-
Terminator: Rabbit β-globin polyadenylation signal (β-globin polyA)
Simian virus 40 polyadenylation signal (SV40 polyA)
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Simian virus 40 bidirectional origin (SV40)
Host range: Escherichia coli
Mammalian cells; SV40 permissive cells
Parental clone: pCAGGS
Further information: Full-length mABIN-2 cDNA was constructed by assembling a 5' RACE fragment and the EST clone AA105249 by fusion PCR.
The plasmid was constructed by inserting the XhoI-BglII cut PCR amplicon, containing the mABIN-2 coding sequence fused to an N-terminal E-tag, in the XhoI-BglII opened pCAGGS vector.
pCAGGS-E-mABIN-2 is useful for highly efficient expression of mABIN-2 under the control of the AG promoter and the human CMV-IE enhancer in various mammalian cells.
When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide.
The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727201.1.
The nucleotide sequence of the mABIN-2 cDNA corresponds with the EMBL Nucleotide Sequence Database accession number AJ304865.1.
EMBL Accession number: AJ304865.1, view at EMBL, GenBank, DDBJ
LT727201.1, view at EMBL, GenBank, DDBJ
Latest sequence update: 06/06/2001
Sequence detail:
Primers used for amplification of the 5' RACE fragment:

Forward primer: 5' TTGGAGACGCCCAAGTCCCCACGG 3'

Reverse primer: 5' GCAAGACTACCTCCTTCTCTTGC 3'


Primers used for amplification of the EST clone:

Forward primer: 5' AGAGAAGGAGGTAGTCTTGCTTCG 3'

Reverse primer: 5' GTCCTTGATGTACCAAGTGTGCC 3'


Primers used for fusion PCR of both fragments:

Forward primer: 

5'CCGCTCGAGATGGGTGCGCCGGTGCCGTATCCGGATCCGCTGGAACCGCGTGAATTCGGGATCCGTATGTCGTCTGGGGACCCAAGG 3'
     XhoI     ---------------------------------------               ***
                           E-tag            

Reverse primer:

5'GGAGATCTTCATTGGCAGCACTCAGACAG 3'
    BglII +++

***: start codon of the mABIN-2 gene.
+++: termination codon of the mABIN-2 gene.
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: BglII/XhoI, StyI and XhoI.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Prof. Dr R. Beyaert(1) (2).
(1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: Van Huffel et al., J. Biol. Chem. 276 (2001), 30216-30223 [PMID: 11390377]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 DH5α
Host reference: Focus 8 (1986), 9
Related host reference: Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051]
Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187]
Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791]
Rodriguez-Quinones et al., Focus 15 (1993), 110-112
Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Refer in your Materials and Methods:

pCAGGS-E-mABIN-2 (LMBP 4370) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr R. Beyaert and was published in Van Huffel et al., 2001.

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search