Last data update: 24 January 2024 16:39 CET
Plasmid name: pCAGGS-E-mABIN-2f2 (LMBP 4372)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner non-core plasmid |
Depositor's sequence: | p4372.gb |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Mouse A20-binding inhibitor of NF-κB activation 2 cDNA (ABIN-2, TNIP2); with N-terminal deletion E-tag; N-terminal |
Promoter: | Chicken β-actin/rabbit β-globin hybrid promoter (AG) Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only Escherichia coli lac operon promoter |
Ribosome binding site: |
- |
Terminator: | Rabbit β-globin polyadenylation signal (β-globin polyA) Simian virus 40 polyadenylation signal (SV40 polyA) |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin Simian virus 40 bidirectional origin (SV40) |
Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
Parental clone: | pCAGGS-E-mABIN-2f1 |
Further information: | The plasmid was constructed by inserting a KpnI-BglII fragment containing codons 286-430 of the mouse A20-binding inhibitor of NF-κB activation 2 cDNA (mABIN-2), into the KpnI-BglII opened pCAGGS-E-mABIN-2f1 vector. pCAGGS-E-mABIN-2f2 is useful for highly efficient expression of partial mABIN-2 under the control of the chicken β-actin/rabbit β-globin hybrid promoter (AG) and the human CMV-IE enhancer in various mammalian cells. The AG promoter sequence consists of the chicken β-actin promoter, the first exon and part of the first intron (that seems to have a strong enhancer-like activity) linked to a rabbit β-globin fragment, consisting of a 3' part of the second intron (inclusive a branch point which is required for normal splicing reactions) and a 5' part of the third exon. When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. The nucleotide sequence of the mABIN-2 cDNA corresponds with the EMBL Nucleotide Sequence Database accession number AJ304865.1. Other name of the plasmid is pCAGGS-E-mABIN-2(286-430). |
EMBL Accession number: | AJ304865.1, view at EMBL, GenBank, DDBJ |
Latest sequence update: | 21/06/2001 |
Sequence detail: | Primers used on the pCAGGS-E-mABIN-2 vector to generate the insert : Forward primer 5'AAGGTACCATGAGGATGTCCCGGGACACTGCGC 3' KpnI Reverse primer 5'GGAGATCTTCATTGGCAGCACTCAGACAG 3' BglII |
Authenticity test: | The plasmid still needs to be subjected to the authenticity test. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by S. Van Huffel(1) (2) and Prof. Dr R. Beyaert(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | - |
Related plasmid reference: | Van Huffel et al., J. Biol. Chem. 276 (2001), 30216-30223 [PMID: 11390377] |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 DH5α |
Host reference: | Focus 8 (1986), 9 |
Related host reference: | Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pCAGGS-E-mABIN-2f2 (LMBP 4372) is available at BCCM/GeneCorner. This plasmid was deposited by S. Van Huffel and Prof. Dr R. Beyaert . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.