GREAT AT SMALL THINGS

0

GeneCorner plasmid details

Last data update: 30 October 2020 04:11 CET

Plasmid name: pCAGGS-F-mA20-R727A (LMBP 7787)

Add to cart

New search

Price category: Cat. 1 (cf. price list)
Status: GeneCorner non-core plasmid
Depositor's sequence: p7787.gb
Sequence
analysis results
Genecorner:

-

Cloned DNA: Mouse tumor necrosis factor, alpha-induced protein 3 cDNA (Tnfaip3, A20, Tnfip3, GeneID 21929); mutated sequence
FLAG epitope tag; N-terminal
Promoter: Chicken β-actin/rabbit β-globin hybrid promoter (AG)
Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only
Escherichia coli lac operon promoter
Ribosome
binding site:
-
Terminator: Rabbit β-globin polyadenylation signal (β-globin polyA)
Simian virus 40 polyadenylation signal (SV40 polyA)
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Simian virus 40 bidirectional origin (SV40)
Host range: Escherichia coli
Mammalian cells; SV40 permissive cells
Parental clone: pCAGGS-FLAGmA20
Further information: The plasmid was constructed by introducing a R727A mutation into pCAGGS-FLAGmA20 via site-directed mutagenesis. A silent NheI restriction site was introduced via PCR, amplifying the parental vector from the NheI-location outwards, cutting the resulting fragment with BstXI/NheI and NheI/SalI and ligating both parts into the BstXI/XhoI opened pCAGGS-FLAGmA20 vector.
A candidate site for the putative p75 cleavage site (described in Malinverni et al. (2010) and Wiesmann et al. (2012)) was mutated in mouse A20 via site-directed mutagenesis. The R727A substitution was made along with a silent NheI site for fast genotyping and cloning.
Expression was confirmed by the depositor in HEK293T transfections.
EMBL Accession number: -
Latest sequence update: 11/07/2015
Sequence detail:
Primers used to introduce the R727A mutation and the silent NheI site in mouse A20:

mA20-BstXI-F: 5' TCCAGCCTCACTTCCAGTATC

pCAGGS-R:    5' CCATAAGAGAAGAGGGACAGC

NheI-mA20-LACR/A-R: 5' CCTCGCTAGCACAGGCCAGAATGTTC
                           NheI

NheI-mA20-LACR/A-F: 5' CCTGTGCGCTAGCGAGGAACTCTGTATGG
                              NheI
Authenticity test: The plasmid still needs to be subjected to the authenticity test.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Dr J. Staal(1) (2) and Prof. Dr R. Beyaert(1) (2).
(1) Inflammation Research Center, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: -
Related plasmid reference: Malinverni et al., Biochem. Biophys. Res. Commun. 400 (2010), 543-547 [PMID: 20804738] [DOI: 10.1016/j.bbrc.2010.08.091]
Wiesmann et al., J. Mol. Biol. 419 (2012), 4-21 [PMID: 22366302] [DOI: 10.1016/j.jmb.2012.02.018]
Restricted distribution: - VIB/BCCM MTA
- Restricted to academic users
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061
Host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Related host reference: Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Other culture collection numbers: -

Refer in your Materials and Methods:

pCAGGS-F-mA20-R727A (LMBP 7787) is available at BCCM/GeneCorner. This plasmid was deposited by Dr J. Staal and Prof. Dr R. Beyaert .

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search