Last data update: 20 April 2021 09:48 CEST
Plasmid name: pCAGGS-FLAG-hHNRPK (LMBP 5269)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner core plasmid |
GeneCorner sequence: |
p5269.gb
(View with Genome Compiler) p5269.txt p5269.pdf |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Human heterogeneous nuclear ribonucleoprotein K cDNA (hHNRPK, hHNRNPK) FLAG epitope tag; N-terminal |
Promoter: | Chicken β-actin/rabbit β-globin hybrid promoter (AG) Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only Escherichia coli lac operon promoter |
Ribosome binding site: |
- |
Terminator: | Rabbit β-globin polyadenylation signal (β-globin polyA) Simian virus 40 polyadenylation signal (SV40 polyA) |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin Simian virus 40 bidirectional origin (SV40) |
Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
Parental clone: | pCAGGSFLAGmCASP-11m2 |
Further information: | The human heterogeneous nuclear ribonucleoprotein K cDNA (hHNRPK, hHNRNPK) was amplified by PCR and fused as a Sal/KpnI fragment in the SalI/KpnI opened pCAGGSFLAGmCASP-11m2 plasmid, in frame with the N-terminal FLAG epitope tag. pCAGGS-FLAG-hHNRPK is useful for highly efficient expression of hHNRPK under the control of the chicken β-actin/rabbit β-globin hybrid promoter (AG) and the human CMV-IE enhancer in various mammalian cells. The AG promoter sequence consists of the chicken β-actin promoter, the first exon and part of the first intron (that seems to have a strong enhancer-like activity) linked to a rabbit β-globin fragment, consisting of a 3' part of the second intron (inclusive a branch point which is required for normal splicing reactions) and a 5' part of the third exon. When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT726997.1. The nucleotide sequence of the hHNRPK cDNA was obtained from Genbank (Accession number NM_002140.2). Other names of the plasmid are pCAGGSFlagRNPK and pCAGGS RNPK cl6. |
EMBL Accession number: | NM_002140.2, view at GenBank LT726997.1, view at EMBL, GenBank, DDBJ |
Latest sequence update: | 02/02/2007 |
Sequence detail: | Primers used to amplify the hHNRPK coding sequence: forward: 5' CGGGGTACCATGGAAACTGAACAGCCAGAAGAAACC 3' KpnI reverse: 5' TGCGGTCGACTTAGAATCCTTCAACATCTGCATACTG 3' SalI |
Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: DraI, KpnI and SalI. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Y. Bruynooghe(1) (2) and Prof. Dr R. Beyaert(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | - |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 MC1061 |
Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Cultivation remark: | - |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pCAGGS-FLAG-hHNRPK (LMBP 5269) is available at BCCM/GeneCorner. This plasmid was deposited by Y. Bruynooghe and Prof. Dr R. Beyaert . |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.