GREAT AT SMALL THINGS

0

GeneCorner plasmid details

Last data update: 28 November 2020 04:24 CET

Plasmid name: pCAGGS-FLAG-hHuR (LMBP 5270)

Add to cart

New search

Price category: Cat. 1 (cf. price list)
Status: GeneCorner core plasmid
GeneCorner sequence: p5270.gb (View with Genome Compiler)
p5270.txt
p5270.pdf
Sequence
analysis results
Genecorner:

-

Cloned DNA: Human ELAV like RNA binding protein 1 cDNA (ELAVL1, HuR, Hua, MelG, GeneID 1994)
FLAG epitope tag; N-terminal
Promoter: Chicken β-actin/rabbit β-globin hybrid promoter (AG)
Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only
Escherichia coli lac operon promoter
Ribosome
binding site:
-
Terminator: Rabbit β-globin polyadenylation signal (β-globin polyA)
Simian virus 40 polyadenylation signal (SV40 polyA)
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Simian virus 40 bidirectional origin (SV40)
Host range: Escherichia coli
Mammalian cells; SV40 permissive cells
Parental clone: pCAGGSFLAGmCASP-11m2
Further information: The human ELAV-like 1 cDNA was amplified by PCR and fused as a Sal/KpnI fragment in the SalI/KpnI opened pCAGGSFLAGmCASP-11m2 plasmid, in frame with the N-terminal FLAG epitope tag.
pCAGGS-FLAG-hHuR is useful for highly efficient expression of hHuR under the control of the AG promoter and the human CMV-IE enhancer in various mammalian cells.
When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide.
The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT726998.1.
The nucleotide sequence of the HuR cDNA corresponds with the EMBL Nucleotide Sequence Database accession number BC003376.2.
Other name of the plasmid is pCAGGSFlagHuR.
EMBL Accession number: BC003376.2, view at EMBL, GenBank, DDBJ
LT726998.1, view at EMBL, GenBank, DDBJ
Latest sequence update: 05/02/2007
Sequence detail:
Primers used to amplify the HuR coding sequence:

forward: 5' CGGGGTACCATGTCTAATGGTTATGAAGACCACATG 3'
               KpnI

reverse: 5' TGCGGTCGACTTATTTGTGGGACTTGTTGGTTTTGAAG 3'
                SalI
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: Eco130I, KpnI and SalI.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Y. Bruynooghe(1) (2) and Prof. Dr R. Beyaert(1) (2).
(1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: -
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 MC1061
Host reference: Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493]
Related host reference: Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Refer in your Materials and Methods:

pCAGGS-FLAG-hHuR (LMBP 5270) is available at BCCM/GeneCorner. This plasmid was deposited by Y. Bruynooghe and Prof. Dr R. Beyaert .

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search