Last data update: 12 April 2021 09:56 CEST
Plasmid name: pCAGGS-FLAG-hnRNPC1 (LMBP 5271)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner core plasmid |
GeneCorner sequence: |
p5271.gb
(View with Genome Compiler) p5271.txt p5271.pdf |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Human heterogeneous nuclear ribonucleoprotein C cDNA (hnRNPC, HNRNPC); transcript variant 1 (hnRNPC1) FLAG epitope tag; N-terminal |
Promoter: | Chicken β-actin/rabbit β-globin hybrid promoter (AG) Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only Escherichia coli lac operon promoter |
Ribosome binding site: |
- |
Terminator: | Rabbit β-globin polyadenylation signal (β-globin polyA) Simian virus 40 polyadenylation signal (SV40 polyA) |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin Simian virus 40 bidirectional origin (SV40) |
Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
Parental clone: | pCAGGSFLAGmCASP-11m2 |
Further information: | The plasmid was constructed as follows: 1) The human hnRNPC cDNA was isolated by a 5'-RACE reaction on poly(A)+ mRNA from HeLa cells, using the SMART RACE cDNA Amplification Kit (Clontech); 2) The hnRNPC coding sequence was amplified by PCR; 3) The KpnI/XhoI PCR amplicon was fused to the FLAG epitope tag of the KpnI/SalI opened pCAGGSFLAGmCASP-11m2 plasmid. pCAGGS-FLAG-hnRNPC1 is useful for highly efficient expression of hnRNPC1 under the control of the AG promoter and the human CMV-IE enhancer in various mammalian cells. When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT726999.1. The nucleotide sequence of the hnRNPC cDNA corresponds with the EMBL Nucleotide Sequence Database accession number M29063.1. Other name of the plasmid is pCAGGShnRNPC1. |
EMBL Accession number: | M29063.1, view at EMBL, GenBank, DDBJ LT726999.1, view at EMBL, GenBank, DDBJ |
Latest sequence update: | 02/07/2007 |
Sequence detail: | Primers used to amplify the hnRNPC coding sequence: forward: 5' CGGGGTACCATGGCCAGCAACGTTACCAACAAGACA 3' Primer G * KpnI reverse: 5' CCGCTCGAGTCATCCTCCATTGGCGCTGTCTCTGTC 3' Primer H * XhoI * Schepens et al., EMBO J. 26 (2007), 158-169 |
Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: BglII/XhoI, KpnI and NcoI. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Y. Bruynooghe(1) (2) and Prof. Dr R. Beyaert(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | Schepens et al., EMBO J. 26 (2007), 158-169 [PMID: 17159903] |
Related plasmid reference: | Cienikova et al., RNA 21 (2015), 1931-1942 [PMID: 26370582] [DOI: 10.1261/rna.052373.115] |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 MC1061 |
Host reference: | Casadaban et al., J. Mol. Biol. 138 (1980), 179-207 [PMID: 6997493] |
Related host reference: | Brigé et al., Biochem. J. 394 (2006), 335-344 [PMID: 16293111] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Cultivation remark: | - |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pCAGGS-FLAG-hnRNPC1 (LMBP 5271) is available at BCCM/GeneCorner. This plasmid was deposited by Y. Bruynooghe and Prof. Dr R. Beyaert and was published in Schepens et al., 2007. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.