GREAT AT SMALL THINGS

0

GeneCorner plasmid details

Last data update: 24 January 2024 16:39 CET

Plasmid name: pCAGGS-FLAGmA20 (LMBP 3954)

Add to cart

New search Print data sheet
Price category: Cat. 1 (cf. price list)
Status: GeneCorner core plasmid
GeneCorner sequence: p3954.gb (View with Genome Compiler)
p3954.txt
p3954.pdf
Sequence
analysis results
Genecorner:

-

Cloned DNA: Mouse tumor necrosis factor, alpha-induced protein 3 cDNA (Tnfaip3, A20, Tnfip3, GeneID 21929)
FLAG epitope tag; N-terminal
Promoter: Chicken β-actin/rabbit β-globin hybrid promoter (AG)
Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only
Escherichia coli lac operon promoter
Ribosome
binding site:
-
Terminator: Rabbit β-globin polyadenylation signal (β-globin polyA)
Simian virus 40 polyadenylation signal (SV40 polyA)
Selection marker: Ampicillin (amp)
Replicon: Escherichia coli plasmid pMB1 origin
Simian virus 40 bidirectional origin (SV40)
Host range: Escherichia coli
Mammalian cells; SV40 permissive cells
Parental clone: pCAGGS2
Further information: The plasmid was constructed by inserting a 2.4 kb XhoI-BglII PCR fragment, containing the full-length mouse A20 coding sequence, into the XhoI-BglII opened pCAGGS2 vector.
pCAGGS-FLAGmA20 is useful for highly efficient expression of mouse A20 under the control of the AG promoter and the human CMV-IE enhancer in various mammalian cells.
The expression cassette is provided with an N-terminal FLAG epitope tag, followed by a KpnI site.
When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide.
The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727292.1.
Referring to the sequence analysis results of the Department of Biomedical Molecular Biology (Ghent University, Belgium), the nucleotide sequence of the mouse A20 cDNA corresponds with the EMBL Nucleotide Sequence Database accession number U19463.1, except for nucleotide position 2096 of the coding sequence: the T-residue is substituted by a C- residue, resulting in a Leu/Pro replacement.
Name mentioned in Heyninck et al. (2003) is pCAGGS-FLAG-A20.
Other names of the plasmid are pCAGGS-FLAGmA20(1-775), pCAGGS-Flag-mA20 and pCAGGS-007-002#2.
EMBL Accession number: U19463.1, view at EMBL, GenBank, DDBJ
LT727292.1, view at EMBL, GenBank, DDBJ
Latest sequence update: 12/11/2001
Sequence detail:
Forward primer: 5' AAGCCGCTCGAGATGGACTACAAGGACGACGATGACAAGGGTACCGCCATGGCTGAACAACTTCTTCC 3'
                         XhoI
          
Reverse primer:   5' GAAGATCTTCGTCGACACTTAGCCATACATCTGCTT 3'
                       BglII   SalI 


Nucleotide sequence at the 5' end of the mouse A20 insert:

                   |                               |           | mouse A20
                   |          FLAG epitope         |           | 1               5
5'... TTCCTCGAG.ATG.GAC.TAC.AAG.GAC.GAC.GAT.GAC.AAG.GGT.ACC.GCC.ATG.GCT.GAA.CAA.CTT ... 3'
         XhoI   Met Asp Tyr Lys Asp Asp Asp Asp Lys Gly Thr Ala Met Ala Glu Gln Leu 
                ***                                 KpnI        ***
                                                             NcoI


***: start codon.
Punctuation indicates reading frame.
Authenticity test: Restriction enzyme pattern analysed at GeneCorner: BglII/XhoI, EcoRI, KpnI, NcoI and XmnI.
Class: Recombinant plasmid
Type: Plasmid
History of deposit: This plasmid was deposited by Prof. Dr R. Beyaert(1) (2). It was constructed by M. Klinkenberg(1) (2).
(1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium
(2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium
Plasmid reference: Klinkenberg et al., FEBS Lett. 498 (2001), 93-97 [PMID: 11389905]
Related plasmid reference: Hayakawa et al., J. Immunol. 182 (2009), 1182-1191 [PMID: 19124762]
Coornaert et al., Nat. Immunol. 9 (2008), 263-271 [PMID: 18223652] [DOI: 10.1038/ni1561]
Heyninck et al., FEBS Lett. 536 (2003), 135-140 [PMID: 12586352]
Restricted distribution: - BCCM MTA
Distributed as: H/P active culture or plasmid DNA
Host for distribution: Escherichia coli K12 DH5α
Host reference: Focus 8 (1986), 9
Related host reference: Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660]
Rodriguez-Quinones et al., Focus 15 (1993), 110-112
Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8]
Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187]
Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051]
Cultivation medium: LB-Lennox + ampicillin (100 μg/ml)
Cultivation temperature: 37°C
Biosafety level: L1
Cultivation remark: -
Other culture collection numbers: -

Refer in your Materials and Methods:

pCAGGS-FLAGmA20 (LMBP 3954) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr R. Beyaert and was published in Klinkenberg et al., 2001.

Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.

New search