Last data update: 23 January 2021 04:19 CET
Plasmid name: pCAGGS-FLAGmA20d1 (LMBP 4120)
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner core plasmid |
GeneCorner sequence: |
p4120.gb
(View with Genome Compiler) p4120.pdf |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Mouse tumor necrosis factor, alpha-induced protein 3 cDNA (Tnfaip3, A20, Tnfip3, GeneID 21929); with internal deletion FLAG epitope tag; N-terminal |
Promoter: | Chicken β-actin/rabbit β-globin hybrid promoter (AG) Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only Escherichia coli lac operon promoter |
Ribosome binding site: |
- |
Terminator: | Rabbit β-globin polyadenylation signal (β-globin polyA) Simian virus 40 polyadenylation signal (SV40 polyA) |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin Simian virus 40 bidirectional origin (SV40) |
Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
Parental clone: | pCAGGS2 |
Further information: | The plasmid was constructed as follows: 1) N-terminal and C-terminal fragments of the mA20 coding sequence were generated by PCR. 2) These PCR fragments were fused, resulting in the mA20 coding sequence with the internal deletion of the codons 386 up to and including 468. 3) This 2131 bp XhoI-BglII PCR fragment was inserted into the XhoI-BglII opened pCAGGS2 vector. pCAGGS-FLAGmA20d1 is useful for highly efficient expression of partial mA20 under the control of the AG promoter and the human CMV-IE enhancer in various mammalian cells. The expression cassette is provided with an N-terminal FLAG epitope tag, followed by a KpnI site. When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. The nucleotide sequence of the mA20 cDNA corresponds with the EMBL Nucleotide Sequence Database accession number U19463.1 and adapted to the sequence analysis results of the Department of Biomedical Molecular Biology (Ghent University, Belgium). The following difference is observable: the nucleotide T at position 2096 is substituted by a C- residue, resulting in a Leu/Pro replacement. Other names of the plasmid are pCAGGS-FLAGmA20(Δ386-468) and pCAGGS-007-011#11. |
EMBL Accession number: | U19463.1, view at EMBL, GenBank, DDBJ |
Latest sequence update: | 22/11/2001 |
Sequence detail: | The N-terminal PCR fragment was generated with the following primers: Forward primer: 5' AAGCCGCTCGAGATGGACTACAAGGACGACGATGACAAGGGTACCGCCATGGCTGAACAACTTCTTCC 3' XhoI KpnI Reverse primer: 5' GCACCCAGGACTCCTGCACTT|TATATCCATGAGTGATAGCTGGGG 3' The C-terminal PCR fragment was generated with the following primers: Forward primer: 5' CAGCTATCACTCATGGATATA|AAGTGCAGGAGTCCTGGGTGC 3' Reverse primer: 5' GAAGATCTTCGTCGACACTTAGCCATACATCTGCTT 3' BglII SalI Nucleotide sequence at the start of the mA20 fragment: ------ mA20d ------> pCAGGS2 -> -------- FLAG epitope --------> 1 5' ... GAATTCCTCGAG.ATG.GAC.TAC.AAG.GAC.GAC.GAT.GAC.AAG.GGT.ACC.GCC.ATG.GCT.GAA.CAA.CTT ... 3' EcoRI AvaI Met Asp Tyr Lys Asp Asp Asp Asp Lys Gly Thr Ala Met Ala Glu Gln Leu XhoI *** KpnI *** XmnI RsaI NcoI StyI Nucleotide sequence around the internal deletion of the codons 386 up to and including 468 of the mA20 fragment: ------------------------------------- mA20d ------------------------------------> 385 469 5' ... TCC.ACA.CCC.CAG.CTA.TCA.CTC.ATG.GAT.ATA.AAG.TGC.AGG.AGT.CCT.GGG.TGC.CCT.TTT.ACT ... 3' Ser Thr Pro Gln Leu Ser Leu Met Asp Ile Lys Cys Arg Ser Pro Gly Cys Pro Phe Thr Nucleotide sequence at the end of the mA20 fragment: ------------------ mA20d --------------> ---------- pCAGGS2 ----------> 775 ------- ß-globin polyA ------> 5' ... TGC.TAC.CAG.TTC.AAG.CAG.ATG.TAT.GGC.TAA.GTGTCGACGAAGATCTTTTTCCCTCTGCCAAAAATTATGG ... 3' Cys Tyr Gln Phe Lys Gln Met Tyr Gly +++ HindII BglII SalI | : Fusion point of the N-terminal and C-terminal PCR products. ***: start codon. +++: termination codon. Punctuation indicates reading frame. |
Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: BamHI/KpnI, BglII/XhoI, EcoRI, EcoRI/PstI, NcoI/PvuI, PvuII and SalI/XbaI. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Prof. Dr R. Beyaert(1) (2). It was constructed by M. Klinkenberg(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | Klinkenberg et al., FEBS Lett. 498 (2001), 93-97 [PMID: 11389905] |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 DH5α |
Host reference: | Focus 8 (1986), 9 |
Related host reference: | Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Cultivation remark: | - |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pCAGGS-FLAGmA20d1 (LMBP 4120) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr R. Beyaert and was published in Klinkenberg et al., 2001. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.