Last data update: 24 January 2024 16:39 CET
Plasmid name: pCAGGS-FLAGmA20d5 (LMBP 4844)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner core plasmid |
GeneCorner sequence: |
p4844.gb
(View with Genome Compiler) p4844.txt p4844.pdf |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Mouse tumor necrosis factor, alpha-induced protein 3 cDNA (Tnfaip3, A20, Tnfip3, GeneID 21929); with internal deletion FLAG epitope tag; N-terminal |
Promoter: | Chicken β-actin/rabbit β-globin hybrid promoter (AG) Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only Escherichia coli lac operon promoter |
Ribosome binding site: |
- |
Terminator: | Rabbit β-globin polyadenylation signal (β-globin polyA) Simian virus 40 polyadenylation signal (SV40 polyA) |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin Simian virus 40 bidirectional origin (SV40) |
Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
Parental clone: | pCAGGS2 |
Further information: | The plasmid was constructed as follows: 1) N-terminal and C-terminal fragments of the mouse A20 coding sequence were generated by PCR. 2) These PCR fragments were fused, resulting in the mouse A20 coding sequence with the internal deletion of the codons 547 up to and including 699. 3) This 1921 bp XhoI-BglII PCR fragment was inserted into the XhoI-BglII opened pCAGGS2 vector. pCAGGS-FLAGmA20d5 is useful for highly efficient expression of partial mouse A20 under the control of the AG promoter and the human CMV-IE enhancer in various mammalian cells. The expression cassette is provided with an N-terminal FLAG epitope tag, followed by a KpnI site. When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727048.1. The nucleotide sequence of the mouse A20 cDNA corresponds with the EMBL Nucleotide Sequence Database accession number U19463.1. Other names of the plasmid are pCAGGS-FLAGmA20(Δ547-699) and pCAGGS-007-109#. |
EMBL Accession number: | U19463.1, view at EMBL, GenBank, DDBJ LT727048.1, view at EMBL, GenBank, DDBJ |
Latest sequence update: | 23/11/2001 |
Sequence detail: | The N-terminal PCR fragment was generated with the following primers: Forward primer: 5' AAGCCGCTCGAGATGGACTACAAGGACGACGATGACAAGGGTACCGCCATGGCTGAACAACTTCTTCC 3' XhoI KpnI Reverse primer: 5' GCAGGAGGCCCGGGCACATTT|TTGGTGACAGGAGGCAGGGAT 3' The C-terminal PCR fragment was generated with the following primers: Forward primer: 5' ATCCCTGCCTCCTGTCACCAA|AAATGTGCCCGGGCCTCCTGCAAG 3' Reverse primer: 5' GAAGATCTTCGTCGACACTTAGCCATACATCTGCTT 3' BglII SalI Nucleotide sequence at the start of the mouse A20 fragment: ------ mA20d ------> pCAGGS2 -> -------- FLAG epitope --------> 1 5' ... GAATTCCTCGAG.ATG.GAC.TAC.AAG.GAC.GAC.GAT.GAC.AAG.GGT.ACC.GCC.ATG.GCT.GAA.CAA.CTT ... 3' EcoRI AvaI Met Asp Tyr Lys Asp Asp Asp Asp Lys Gly Thr Ala Met Ala Glu Gln Leu XhoI *** KpnI *** XmnI RsaI NcoI StyI Nucleotide sequence around the internal deletion of the codons 547 up to and including 699 of the mouse A20 fragment: ------------------------------------- mA20d ------------------------------------> 546 700 5' ... ACT.TCC.AGT.ATC.CCT.GCC.TCC.TGT.CAC.CAA.AAA.TGT.GCC.CGG.GCC.TCC.TGC.AAG.AAC.ATT ... 3' Thr Ser Ser Ile Pro Ala Ser Cys His Gln Lys Cys Ala Arg Ala Ser Cys Lys Asn Ile Nucleotide sequence at the end of the mouse A20 fragment: ------------------ mA20d --------------> ---------- pCAGGS2 ----------> 775 ------- ß-globin polyA ------> 5' ... TGC.TAC.CAG.TTC.AAG.CAG.ATG.TAT.GGC.TAA.GTGTCGACGAAGATCTTTTTCCCTCTGCCAAAAATTATGG ... 3' Cys Tyr Gln Phe Lys Gln Met Tyr Gly +++ HindII BglII SalI |: fusion point of the N-terminal and C-terminal PCR products. ***: start codon. +++: termination codon. Punctuation indicates reading frame. |
Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: BamHI/KpnI, BglII/XhoI, EcoRI, EcoRI/PstI, EcoRV/SalI, NcoI/PvuI, PvuII, SalI/XbaI and SpeI/XbaI. The SalI site at position 1918 could not be experimentally confirmed. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Prof. Dr R. Beyaert(1) (2). It was constructed by M. Klinkenberg(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | Klinkenberg et al., FEBS Lett. 498 (2001), 93-97 [PMID: 11389905] |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 DH5α |
Host reference: | Focus 8 (1986), 9 |
Related host reference: | Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Cultivation remark: | - |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pCAGGS-FLAGmA20d5 (LMBP 4844) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr R. Beyaert and was published in Klinkenberg et al., 2001. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.