Last data update: 24 January 2024 16:39 CET
Plasmid name: pCAGGS-FLAGmA20f5 (LMBP 3956)
New search | Print data sheet |
Price category: | Cat. 1 (cf. price list) |
Status: | GeneCorner core plasmid |
GeneCorner sequence: |
p3956.gb
(View with Genome Compiler) p3956.txt p3956.pdf |
Sequence analysis results Genecorner: |
- |
Cloned DNA: |
Mouse tumor necrosis factor, alpha-induced protein 3 cDNA (Tnfaip3, A20, Tnfip3, GeneID 21929); fragment FLAG epitope tag; N-terminal |
Promoter: | Chicken β-actin/rabbit β-globin hybrid promoter (AG) Human cytomegalovirus immediate early promoter (CMV-IE); enhancer only Escherichia coli lac operon promoter |
Ribosome binding site: |
- |
Terminator: | Rabbit β-globin polyadenylation signal (β-globin polyA) Simian virus 40 polyadenylation signal (SV40 polyA) |
Selection marker: | Ampicillin (amp) |
Replicon: | Escherichia coli plasmid pMB1 origin Simian virus 40 bidirectional origin (SV40) |
Host range: | Escherichia coli Mammalian cells; SV40 permissive cells |
Parental clone: | pCAGGS2 |
Further information: | The plasmid was constructed by inserting a 1825 bp XhoI-BglII PCR fragment, containing codons 1 up to and including 590 of the mouse A20 coding sequence, into the XhoI-BglII opened pCAGGS2 vector. pCAGGS-FLAGmA20f5 is useful for highly efficient expression of partial mouse A20 under the control of the AG promoter and the human CMV-IE enhancer in various mammalian cells. The expression cassette is provided with an N-terminal FLAG epitope tag, followed by a KpnI site. When cloning a fragment downstream from the lac promoter it may be advisable to use lacI(q) strains in order to prevent fortuitous expression of a possibly noxious polypeptide. The nucleotide sequence of this plasmid corresponds with the EMBL Nucleotide Sequence Database accession number LT727294.1. The nucleotide sequence of the mouse A20 cDNA corresponds with the EMBL Nucleotide Sequence Database accession number U19463.1. Other names of the plasmid are pCAGGS-FLAGmA20(1-590) and pCAGGS-007-004#4. |
EMBL Accession number: | U19463.1, view at EMBL, GenBank, DDBJ LT727294.1, view at EMBL, GenBank, DDBJ |
Latest sequence update: | 14/11/2001 |
Sequence detail: | Forward primer: 5' AAGCCGCTCGAGATGGACTACAAGGACGACGATGACAAGGGTACCGCCATGGCTGAACAACTTCTTCC 3' XhoI KpnI Reverse primer: 5' GAAGATCTTCGTCGACACTTAGCTTGTCCCTGCTCT 3' BglII SalI Nucleotide sequence at the start of the mouse A20 fragment: ------ mA20f ------> pCAGGS2 -> -------- FLAG epitope --------> 1 5' ... GAATTCCTCGAG.ATG.GAC.TAC.AAG.GAC.GAC.GAT.GAC.AAG.GGT.ACC.GCC.ATG.GCT.GAA.CAA.CTT ... 3' EcoRI AvaI Met Asp Tyr Lys Asp Asp Asp Asp Lys Gly Thr Ala Met Ala Glu Gln Leu XhoI *** KpnI *** XmnI RsaI NcoI StyI Nucleotide sequence at the end of the mouse A20 fragment: -------------- mA20f --------------> ---------- pCAGGS2 ----------> 590 ------- ß-globin polyA ------> 5' ... ACT.CCA.GGA.GAC.AGA.GCA.GGG.ACA.AGC.TAA.GTGTCGACGAAGATCTTTTTCCCTCTGCCAAAAATTATGG ... 3' Thr Pro Gly Asp Arg Ala Gly Thr Ser +++ HindII BglII SalI ***: start codon. +++: termination codon. Punctuation indicates reading frame. |
Authenticity test: | Restriction enzyme pattern analysed at GeneCorner: BamHI/KpnI, BglII/XhoI, EcoRI, EcoRI/PstI, NcoI/PvuI, PvuII and SalI/XbaI. |
Class: | Recombinant plasmid |
Type: | Plasmid |
History of deposit: | This plasmid was deposited by Prof. Dr R. Beyaert(1) (2). It was constructed by M. Klinkenberg(1) (2). (1) Department for Molecular Biomedical Research, VIB, Ghent, Belgium (2) Department of Biomedical Molecular Biology, Ghent University, Ghent, Belgium |
Plasmid reference: | Klinkenberg et al., FEBS Lett. 498 (2001), 93-97 [PMID: 11389905] |
Restricted distribution: | - BCCM MTA |
Distributed as: | H/P active culture or plasmid DNA |
Host for distribution: | Escherichia coli K12 DH5α |
Host reference: | Focus 8 (1986), 9 |
Related host reference: | Woodcock et al., Nucleic Acids Res. 17 (1989), 3469-3478 [PMID: 2657660] Rodriguez-Quinones et al., Focus 15 (1993), 110-112 Hanahan, J. Mol. Biol. 166 (1983), 557-580 [PMID: 6345791] [DOI: 10.1016/s0022-2836(83)80284-8] Hanahan, in 'DNA Cloning: A Practical Approach Volume I', IRL Press, Oxford (1985), 109-135 [ISSN/ISBN: 0947946187] Grant et al., Proc. Natl. Acad. Sci. U.S.A. 87 (1990), 4645-4649 [PMID: 2162051] |
Cultivation medium: | LB-Lennox + ampicillin (100 μg/ml) |
Cultivation temperature: | 37°C |
Biosafety level: | L1 |
Cultivation remark: | - |
Other culture collection numbers: | - |
Refer in your Materials and Methods: |
pCAGGS-FLAGmA20f5 (LMBP 3956) is available at BCCM/GeneCorner. This plasmid was deposited by Prof. Dr R. Beyaert and was published in Klinkenberg et al., 2001. |
Note: Up-to-date, validated data are enclosed with the biological material. Nevertheless, these data are a snapshot at a given moment; further updates are always possible.